Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26640  (registered. 2012)
Contig Information
Length 896 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115439141|ref|NP_001043850.1|| Os01g0676900 [Oryza sativa (japonica cultivar-group)]
Score 290
Evalue 2.00E-76
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26640
ACACATCTATGTTTGTATAGTAGTACAATCAAAACGACTTGCATCCATATGGCCATACCCATACAACATCATGTCTTGACGTAAAAAATAATGTGAATTG
CTATTCCTCTCTTTTTATCTTTTGCGCATTACACAAGCTGGCAAATCCTTGGTTCTAGCTAGTGGCACCAATTCAGAAACTTATTGCACCACAAGGAAGG
AAAACCCCATGCAGGCTAAAGAAAGGAACTGTCGTATAAGATCAGAGGAGAGATGAACGTAAGAAGGAGAAGAACATTTGAGGATCATAGCTTGAGCTCG
AGATCCACGTCTTCTGGATCGTCGGAATTCATACTCGTCGAATCAGCCGACCGGCTCCGGTCATGGTGCCCTCTCAGACGGGTAGATTCCTCTGGTGCAA
ACAGTGGCAATGTGACACCAGGATGCGCGTAATGTGGTGGCCCGTAGATAGTGCTGCTGCTTGGTGATCTTACGATGGGAGTCTGGAATTCACCATATCG
AGCGTCTCCTCTCTCCCCATATGCCATCCCAAAATTCGGATGGACCGGGAAGGCCGACGAGACGGCGGTAGCCTGGAAGGGGGACGATGGGGACGATGAG
AGCGAGGACGTTGACGCCCGCGTATCCTCCAAATTGAGGCTGGCCGTTCTGTGGATCAAGCTCGGTGGCTGACCACCAAGAGGATGGAAGTACTCAGCCA
TTTCGCTCTGTAACCTAATCTTCTCGAGCTGCGCCACGCCGAGCCCCCGCTGCGGCTGCTTCGGCTTGTCGGCGCCACTGCCGCCGCTGCTGCTGCCGCC
TCTCTTGCCCTTCCTGGAGCCGGATGATCTGCCCCACCCCATGCTGTCCCCAAAGTTGTTCCCACTCATATCCCCGAAGAGAGACCTAGCAGGAAG
page-top