Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26612  (registered. 2012)
Contig Information
Length 937 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218189400|gb|EEC71827.1|| hypothetical protein OsI_04480 [Oryza sativa Indica Group]
Score 194
Evalue 1.00E-47
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26612
TGCTGCTGTATACTGGAGCGGATTCCCTCTACTTTATACCATATCTATAGTACGACAGGCTAGCCTCACATCACCACTTTCCACCACACCGTGACTCCGC
AAGCATCCACGGCCATGGAGATAGAATGACACGCGACACCAGCGGAACGGACACGTACGGCTACTAGGGGAACCCACGGCCGAGCGCAACCGACAAACCC
GTGGAGCCGCGAGCCCGATCTACCACACCCTCGCCCTCCCGCCGTCTCCGGCCAACTGCCCCCACTCGCCGGATTTCCAGAAAGGGGAAGAGGAAGCAAG
CCGCCGAACATTCATCGCGGCATGCACCGACCATTGCACCCCTCCTCTCAGCTCTCCCCGTAAACAAGCCAAAGTAAAACGAGAGATTCTTGCGCTGTGC
CGTGTGAATGTATAAGCTGCACTTGCAAGCGTAGTAGTACTAGTATTTGCTTCGTGGTTGGCCAAGCACATGGGAAGAGAAGTGCGTGGACTTCTTGCGG
GTGGTGGAGTAAAAAAATCCTCTCTTTCTTTCTACTATACTCTTTTTCTTCGTGTTCTGGGACGTATCGACGTGGTGTGCTGCTGGATCTCGGAGTCCGG
CCGGCGGGCGCGCGCGTCAGTCGAGGGGGTAGCATGTGTCCTCGCCGCCCGTGTTCCACAGGAAGTGCGCGTAGGCCGCCGCGTGGTGCCCGTTGCTCGG
CTCGGCGGCGATGGCCTCCTGGAACGTCTCCTCCGCGGCCGCCAGGTCGTTGCGCGCCTTCCACAGGAACGTCGCGTACCACCCCAGCGTCTCCGCGTCC
GCCGGCTGCTCCGCGCGCACCGCCCGCTTGAAGTAGTGCTCCGCCCGGTCGTGATCGCGCTGCACCAGGTACAGGAACTGCGCGAAGTTGGCGAGCAGCA
GCGCGTTGCTGGGCTCCTCGGACACGGCCATCGCGTA
page-top