Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26608  (registered. 2012)
Contig Information
Length 1246 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222618986|gb|EEE55118.1|| hypothetical protein OsJ_02894 [Oryza sativa Japonica Group]
Score 575
Evalue 5.00E-162
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26608
TCAATCACCGATAAGGACTGGGATGATATTAAGTTTGGGGTGGAAAATCAGGTTGACTACTATGCTGTTTCTTTCGTCAAAGATGCTCAAGTTGTGCATG
AATTGAAGGATTATCTCAGAAGCTCGAATGCGGATATACACGTAATTGTGAAAATTGAAAGTGCAGATTCTATTCCAAACTTATATTCAATCATTACAGC
ATCTGATGGGGCTATGGTTGCCAGGGGTGATTTGGGGGCTGAACTTCCTATCGAGGAGGTACCATTGCTGCAGGAAGAAATTATTNGAATGTGCAGAAGC
ATGGGAAAAGCTGTCATTGTCGCCACTAATATGCTGGAAAGCATGATCGTTCATCCAACTCCAACCCGTGCAGAAGTTTCAGACATTGCTATAGCTGTTC
GGGAAGGTGCTGATGCAGTTATGCTTTCTGGGGAAACTGCACATGGAAAATTTCCCTTGAAAGCTGTCAAGGTCATGCATACTGTTGCACTAAGAACTGA
AGCAACTATTATTGGCGGGGAAACACCGTCTAACCTTGGTCAGGTGTTCAAGAACCACATGAGCGAAATGTTTGCCTACCATTCAACAATGATGTCCAAT
ACACTTGGTACATCAATTGTGGTTTTCACAAGGACGGGATTTATGTCTATCCTACTTAGCCATTACCGGCCATCTGGCACCATATTTGCCTTCACAGATC
AGGAGATAGTTAGACAACGACTGGCTTTGTACCAAGGTGTATGTCCAGTTCACATGGAATTTTCTGATTGTGCTGAGAAGACATTTGCTGATGCTTTATC
TTACTTGCTGAAGCATGGTATGGTGAAGGAAGGTGAGGAGGTTGCACTCGTTCAGAGTGGCAGACAACCCATCTGGAGGTCGCAGTCCACCCACAATATT
CAGGTTAGGAAGGTTTGATGAGGAATGCCCATTTGCACGACCAGTAACCGAGGTATTTGCTGTGATTGAGGCAAACACAAAGGTCCGGTTATGATGCCAT
GCCGGCATTACTGGCCTTGAGCCATGAGCTTGATAGCATGTGTACTACGTATATTTGTTGTTTGAGAGAGTGTTGTGATTCTATTCTCTCTTGCTGTTTA
CTACTCTTGTGTGTAAAATGATTCAGACCAATCATTTCCTCCATCTGTTTTTAGCTGTAGCTTGGGAGTGCTGTAGGGTTCTTTATTTTGTAAAACAATT
TATGTATTAATACATTACAAAGATTTGTTCGACAGGAAAAAAAAAA
page-top