Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26607  (registered. 2012)
Contig Information
Length 719 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XT Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|154296450|ref|XP_001548656.1|| predicted protein [Botryotinia fuckeliana B05.10]
Score 199
Evalue 2.00E-49
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26607
CAGCGACAGCGTTACAGCAGCCTCAACATACAACAGATCATGGCAGTCTTTCTACCAGAGAGATTAAGGACACTGGGCCATGAAGTTGCAAGCCTACTCA
AGGAGAGAGGCCACACCGTTGCCGTGGCAGAGACCGCTTCAGGTGGCCTCATCTCTGCAGCACTCCTGTCCTACCCAGGAGCATCAAAGGTGTACAAAGG
CGGCCTGACCATCTACACTCTCGAGTCTCGGATGGCCTTTGCCGGCTGGACGCAGTCCGACGTCGACGACTACAACGGACCCAGCCCAAGTGTGGTCTCA
AAGCTGGCAGAGAATGTGAGGTCAACTCTGGGAGCGACCTATTGCATCTGCGAGAGCGGCACTGCTGGTCCAAACGCACCCGTGCGCGGTACCTCGAAGA
GCAAGATCCCAGGTTACGTTGCACTCGCGGTTGCGTCTGCGACGGGACAGACCAAAGCCAGAGAGAGCGGCACCGAGCTCGGTGGAGACAGAGAGCAGAA
CATGGTAGCTTTTGCTGTCCTGGCCTTAGAGCTGCTCGCAGAGGTGGTCAGGGAGTCCCAATGACTCCGCTAGTCATTATGGGAGGAAGCGATGCCTCAG
ACATCTTGATAACGACCGAGACAAGACGTGTCGCTCGCTGTCTCAGATTCGTCGTCAGAGTCAACATCGGGGCGTCCTCAGGATCAGTGGCAAACTGAGT
CGGAATCACAAAAAAAAAA
page-top