Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26603  (registered. 2012)
Contig Information
Length 1025 bp
Clones alternative view 32 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_OKCS Seed DPA5 4
Wh_VHS Shoot with heat shock treatment 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 3
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115476734|ref|NP_001061963.1|| Os08g0455800 [Oryza sativa (japonica cultivar-group)]
Score 378
Evalue 7.00E-103
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26603
TTTTTTTTTTGCATGTAAAATTCCATTCTATTATACTATTTACATCAAATTCTTATATACTTTCAAAAGCTATTATTTCAAATATTGATGTTTCGTGTAA
CCAAAAACCTCATTGAAATATTGCAAAATATTCCCGCAACAACGTGCGGGGTATCATCTAGTTCCACTAATTATGGTACATAAAAATGTTACAACCAGGC
AACAGCACCAGCACAGGAGTGCTCTTTCAGAGTGACAAGACTGAAAATACAGACCTCGTAGAATCACAGAAAATGGCATCCAAAGCCAATACAGGAAGGC
CGGATAATGCCATAATATATAGACTGCTAGCAAGCAACATGAACGGCTCTGATCCTGCTTACTTCTTGGAAGGAATAAGGTAGTTGAGGAAGGGTTCTGC
CTTCGGGGCAATAGACTTCACATCATCAAAAGAGGCCATTTCAAAATCCTCATACTCAAAGCCAGGGGCACAAGTGCAGCCAACGAGGGAGTAGTGCTTC
TCGGGATCTCGCTTCCGAGAGTTGACAAGATGGCTGCCATCAGATGCAAACGACTCGACATCCAACGTGGGGAAAGATCCAAACCACACATTTGGTGGCA
CGGTGTACTGGGGGCGCTGCCCAGCGTCTAGGTGCGGACCAATTACGGTGAGGTCAATGTGGCCATCGTCGTGTAGCTCGAAGACCGTGAGAGGCTCTCC
CTTGTAGAAATGCCAGGTTTCAGCACAAGGAATACGATGCAGATGTGAAACACTCCCTGAAGGAAGCAAGAAATAGATAGCGGTGCTCACAGCACGACCG
ACCTTGTACTGCGGCGGGAGCTGGGCGGTGGTGAGGGAGACGGAGGAGTCGCGGAAGGTCTCGGCGTAGAAGCCGCCCTCCGGGTGCGGCTTCAGATCCA
GCAGCGCCGCTACCTCCGTGGCCGTCATCTCGCAGGAGCCCATCTCTGTCGCTGTCCGCTTCGAGGTCCCTGGCTTTCTGGTGGCGAGGTAATCTAGGGA
TCGTTGAGCGGAGCCGGAGCCGCCG
page-top