Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26602  (registered. 2012)
Contig Information
Length 1131 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|90399276|emb|CAH68237.1|| H0306F03.4 [Oryza sativa (indica cultivar-group)]
Score 599
Evalue 2.00E-169
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26602
CCACCACGACTCTGCAGCAGAACTACAGCCAAGATCCAAGTCAACGGTACCGACGCGACATGTTTTTTCTTCATTCATGGACACTGGACGTCTAATGTTT
CGACAGCAAAAGAAAACCTAATTACGCAAGATAGCGGTAGAGCTTCCTATCTACCTTGTCCCTCTCCAGGAACTCGCGCTCGATCAGGGACTCGATCCTC
TTCTTGATCACCACCGGGTTCGGCAGGAAGCGCGCCTGGAGCTGCTTCGTCACCTCCGTCACTATACTGTTGTGGTCCAGGACCCTCCTGGACTTCATGA
TCCTCACGATGGCCGCCTCGATCTGGGGCTTCCGGTCCTCCTCGACCCTGTGGCGGGTCTCCTGCTTCTCTGGCTCTGACTCCTTCTGCGCAACGACCGT
GCCAATCTTCACCTTCACCAACTTGCTGCTGAACTTGTCGTTGAAGTGGAAAGCGTCGCTGTCGGATATGTCCTTGCTCATGGGCTCCTTCCGCAGCACG
TTCTTGCCCTTCACACAGGCAAGAGACTGGAGGCAGCGCTTCAGATCAACAGGTGGTATGGCTGTGTTCTGCTCAATTTCCTTGTAGGTCAAAGTATCTG
TTGAGTTGAATAGCATCAGGACACACATCTGGTAAGTCGAGACATTCAGCTCATGCTTGCGGTCTCCAAATGTTGCCTTGATGTCTGCATTCCCCATATT
TGTCTGCCATGTCAGTCTCCTGCCATTGTGCGTGCCCAGGTAGTGTGCCCGGAACTGCTCAGAAACACCAAGGATCTCAGGTGGAAGATTGCAGGTAGCG
CATGGCTGTGTTGGCCAAGATCCAGTGGTGAGTATCTGGACAGATATTGTTGGGCCGTCACTGTCACCAGCGAGATTGGCATAGAAACTTTGCATTGTAT
CCTGAGACGTCTTCAAATCAGTGAACATGCTCTCCAGCTTTGACGTAAACTGGTAGCCACATTCTGTCTTCAGCTTCACAAGCATGTTCCTCTCAGCTTC
ATCAGAACTAGTTTTCCCAGATAGAAGGCGTTTTGCCAAGTGCTGCTTGTAATACTTCTCAAAAACATCTTTCTCCTGCAAGTACCTGAACAGCATCATA
ACCTTGTCCAGAACTGTCTCAATATCCTCTT
page-top