Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26599  (registered. 2012)
Contig Information
Length 1077 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 2
Wh_VABA Shoot with ABA treatment 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218197321|gb|EEC79748.1|| hypothetical protein OsI_21120 [Oryza sativa Indica Group]
Score 420
Evalue 1.00E-115
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26599
TCCTTTGGCCACAGCTGCTGCTGTATATATGAAACCCAATGTACTGACCACCAAATTGCTCTTCTACTTACTGCACACTCCCCTGACCGACCGACTGACT
GACTGCAAGGGGGGGTTGGGTGCCCATTCCACCCCTCCCCATTCTATTGCACATACACAAATGGTACACTGATAGTACACTATTACACAAACACATGATA
CAAATATCCCTCCTGCAAAAAACACAGCTGCGCGACTACCTGGTCCAGGCCCGAGGCCTGACCCGAAACAGCCATCAAGTAGCACGACGCGCGCCCGCCT
GCCTGTCTACCCTACGCGCCGTGGTTCCGGGCTTCAGCGGAACGAGAACGCAATCTCCTCGAGCGTTCTCCCCTTGGTCTCCGGCACGCACAGGCACACG
AAGAGGAGGGTGCCCATGGACACTGCCGCGTATATAGCAAAGGTTCCTCCGTTGCTCCAGTTTAGCATCAAGCTCGCGGTCATCGTGATGAGCCACGACG
TCATCCAGTTTGCAAGGGTGGCGGTGCTTCCGGCAAGACTCTTGATGTTAACAGGAAGAATCTCAGACATTATAATCCATGGGATGGCTCCCATGCCCAG
AGAAAATGCAAGCACAAATGCCACAAGTCCAGCCAGTGAAAGCATACTCATCACAAAGTGTAAATGAGAAGCTTCGTCTATGTTGTCCTTCACAAAAAAT
GACACAGAAACAACGAGAAGACTGATTGTCATCCCTGTAGCAGAGATAATGAGAAGTAGCCGTCGACCAGCTTTGTCAGTCAACCAGGTTGTGATTCCAG
TAGCAACCACCTGAACAGCCCCCAAACCACATGTTGCGAGATTACTGTTTTTAAGACCAGCAGCTTTGAAGATACTTGCAGCATAGAAGAAAATGCCGTT
GACACCACTTAGTTGCTGAAGTATAAGGAGGCCAATTCCTATCATAAGAGGAACACTATATCTCTTGTGTTTGATCTCTGCAAATCGTATGGTTGTCCTC
CTCCTAGATGAGGCAACTGATCTCTTTATTTCATTTACTTCTGCTGAGATATCAGTTTCAAATCCGCGCAGGACCTG
page-top