Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26598  (registered. 2012)
Contig Information
Length 777 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|253761573|ref|XP_002489163.1|| hypothetical protein SORBIDRAFT_0015s004030 [Sorghum bicolor]
Score 190
Evalue 1.00E-46
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26598
TTTTTTTTTTGAGGGCATTTAAATCATTAGAGATAGACATTACGAGGCATGCCAGGAACAATGGAGAAAATGTGCATACAGAACAATTAAAACCAAATCA
AAACACATAAAAACATGGTTCAACCAAGACATTTAGCCCACAAAGTTCACTAGCACTTTTTTTTGACCGGGACAAGTACATAAGCAAGCAATATAACCCA
GATAGTTGCATTACATGTAATACATGATAAATCAACTAAAGAAATTCAATCTCCAAGGTCACATCCAGCTCCCAAGTTTCAACAAACATGGTTGAAATTT
CTTTGTCCTAGCCAGTTCTTCGCAGGAACCTCAGATGGTTTACCCTCTTCAGTTTGTTTATTCGATAGAGCTCGCTTCTACCTTAATATTGCTCAGGTAC
CCCTGCAGATCTCACTAGTGCAGAAGCTGGACAGGTAATCGAACTTCTTGACATCAAGCTCAGCCAATCCTCGCAGTGTTGACTTCTTCACATCAATAGC
AAACATCAGTGCCAACTTGTCCATGTGCTTGGGTGTGGTTTCAGAAAGCAAGTAAACGATGTCATCATCCATGCTTAGGATGGGGTGTCCCACTTGAAGT
TCCTTCATGGTCTTGCTGCTCAGCATAGCCATGCGATCAGAAAGGCATGGCTCCAAGCTGATGTCTTTAACATCAAATACACAGTCACGGTTCCAGCGCT
CCTGCAAACCAACGGGTATTGCCATGCTCCATGTTGTGGACTTCCAGCCATCGCGGATGACATGAAGAGATTTCCTT
page-top