Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26597  (registered. 2012)
Contig Information
Length 719 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XT Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|3702665|emb|CAA07474.1|| pathogenisis-related protein 1.2 [Triticum aestivum]
Score 348
Evalue 3.00E-94
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26597
TTTTTTTTTTGAACAACAAAACAAAAGTAAAGATGTTTGCATGGACGTAGAACATATATGATTACATTTACACGCTGCACAGAGCCGCATGGATACATGT
AGCCGGAATGTGTGCTTATTTACGTACGTACGTAACATTTGTAGACGTATAAATATTCAAACCACACGAACATAAACACATGCACGTACGTATGCATGTA
TGATCACACTCACACGCACGTACTACTTGGCTTCGGCGTCAAGGGTGAGGAACGCGAACGGGCGCTCGCCGTTGAAGTTGCCCGGGGGGTTGTAGTTGCA
GGTGATGAAGACGCCCCGGTTCCCGGCGCAGACCACGCGCGCGCAGCCGATGCGGGTCGACTTGCGCCACACCACCTGCGTGTAGTGCCCGCACACCTTG
CCGGCGTCGCAGGTGTTGCTGTCAAGATGGTAGTTCTGCTTCTCGTCCACCCACAGCTTCACCGCGTCGGCGGCCGTCCACGACTGCCCGGAACCCCAGA
AGATGTTCTCGCCGAACGGCCCGCCGGAGTGCTGGAGCCGGCAATCGCCGGCGCGCTGCGCCGCCCAGTCCTGCGCAAACCTGGCCACGTTGTTGTCCCA
CGCCACCGGGCCGACACCGTCCACGGCGCGGGCGCGGTTGTGCAGGTTGACGAAGTCCTGCGGGGTGTTCTGCGCCGAGACGTCAGCCACCACGGCCATG
ACTATGGCCAGTGCGAACA
page-top