Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26592  (registered. 2012)
Contig Information
Length 1345 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242034479|ref|XP_002464634.1|| hypothetical protein SORBIDRAFT_01g022240 [Sorghum bicolor]
Score 701
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26592
AATGCTGGGGTACTCCACATTCCAGGATCTAGCCGAGGGGTTCTTTCAAAATCAGAGCATCTTTCCAGCAAAAAAATAAGTACAGTACATTTGAACATAT
TTCCACTAAACAGGCAGATACATTCAAGCTTGGAGAACTTGACAATGTATGATGTGGGCCTTCAAATTACGACCTGCAATTGCTGACCACAAGTTCGCCA
TCAAAGACCTGTGCTGGTGGCCCTTCCGGGCAAAAGTCTCCCACACACGGGCACTCTCCATCTCAATAACTTTTGTTGGGTCACAGACATCAACAAGGGT
CATGCCCATGTTATTACGGATAACACAGATCTTTCCATTCAGTGAGACCAAAGCCACGGCTTCAAAAGCTCGTGAGCTGCCCAGATGGCGTCTACTGTCC
ATGAATCTTGTCCACGATCCTATGTCCCCATCATAAACTCTTAGCTTGCAGGCATCCCGACAATCCGCTGAATAAAGACGACCATTAAAGGAAATGGTTG
GATTCCGCAAGCCTGCAACCAGTGCATTACCAGTGGTTGACCACGTGTTGGATGTTGGCAGATAGACCTCGCTCACAACCTGGCGGTGAGAATCAAGTCC
TCTTAGGAACCATTTGCCATCATATACAATTCCAGTGAACGGCACCATTCCTGTGCTCATTTCAGTGATGCAAGACCATCTATTCCTGTTCGGATTGTAA
ACCTCAGCAGACCTCAGAGTTCTCTGTGTCCCTTCACATTCCCCGCCGGCAACATAGAGACAGTTGTTTATGACACAAGAGCCAAACAAGTGCCGCTTCC
GTAGCATATCTGGAGCCCGGTGCCACTTGTTTGTCCGAGTATTGTAATACACAACATGCCTCATAGACCCCCGTACTGGGTTTTTGCCACCAAATAGGTA
CAAATAGCAGCCACTGAGAACAGCACAACCAAAGCCCACGGCTTCCGAATACTCTGGTGGAACTGGAGGAAGTGACCTCCAGAGCTGGTGCGCTGGATCA
AAGGCATGCCAAGACAGTTTCTGATCACGATCCCTTTTGAAGACGTAAACCCATTCTTCTGCCATGCCAAATTTCTTCCGCAGGGAGTAATAGTAATTCC
CAGATAAAAGTCGGCTCCACTTTTTACAGACTAAACGAAGATTAGGGTGCTCGGCTCGAGAAACCCGCATCAGACATGAAATAGCCAGGTCATCAGGAAG
GCCAGGCAGAAGCGGCGCCTGATTTCGGCACCTCTCCTTGCGTGAGCTCCTTGTCTTGCGCTTGTTCGGTTTAACATCAGGTTGCATGCACAGCCTAGCA
CCAGGGACAAACTTTCTAGCATTGACGACAGTTTAAGGCCCCCAT
page-top