Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26591  (registered. 2012)
Contig Information
Length 843 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242044674|ref|XP_002460208.1|| hypothetical protein SORBIDRAFT_02g024630 [Sorghum bicolor]
Score 343
Evalue 2.00E-92
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26591
TTTTTTTTTTGGGCTTAACTGTGATGGACTGCAATTATTGGTCAGGGCAGTGTGCTTTTTTACACAAATTGGAGCTGTATGTATGTGTGGACGTCAGCTC
CGTCAGAAGCAGGCTCCGTCCGGTATGAGTGGTGGCGCCCATGAACGGATGGTGCTGCTTTACTGTCTCTAAATAAAAAGCTCGGGTGCAACAACATGGC
GCGTCGATGAAAATTTACCGGCAAAAGGCGATATGAGTCGATGAACTCAGTCAGGGCCACCCCAGTGTAGTTCCCTCACACATGTGGCTCATCTTCCTGA
TTCCTGCAGGAAGTCGTAGAGCTCCTCTGCAACGGCCAAGGGGTATTCTTCCTGCGGCAGAAGCGCGCCCGGGACCTCCACGAACTTGGTCACGCCTTTG
GCGCCCTTGAGAGCCTCCATCTCGGCCTTGGACCTCTTGGGGGAATTCAGCGTCGACACCACTAGAACAGGGACATCTCCATCCAACTTGGCAAACAGCT
GCAGGAACTCCTCCCTCGATTGGACAGGGTCGAGGAGGCCCGTCAGGAACGCGGCAGGGACGTATCGCGCGCCTTTTCTTTTGGTCAATTCGTAGCGGCT
TTCGACGATTTCCGGTGTCACATTCTCAGGGTTGGCATACACATGGGACTTGTACTGGGACTGGATGGACTTTTCGTTGCTCACCAGAAGATTGTACATC
ATCCAGCCAATGGCTGGGGCCCTGAGGGTTCCTCGTAGAAGCCCGTACCTTGTTTCCATATCAGAACCTCGGCCAAATACAATGGGAAGGGGTCCAGCCC
AAGTAGGTGCAACAGCAGCAACCGCAGATGGTCTGATAAGGCC
page-top