Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26588  (registered. 2012)
Contig Information
Length 781 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XT Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222619321|gb|EEE55453.1|| hypothetical protein OsJ_03614 [Oryza sativa Japonica Group]
Score 347
Evalue 6.00E-94
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26588
CCCCGCCCGCCTCTCCCCTAAACCCTAGCACGCGAGCCCCGAATCCCCAAACTCTCCGCGGCGATCGCCGACGCGACCCAACCCCGCGGCCGCCCGTAGC
GGCCGCCGCCGCCGCACATGACCATGGTGACTCCTCGCGCCCCCGAGCCGCCGCCGCAGGACCAGGACGAGGAGATGCTTGTGCCACAACAGGAAGTGGA
GGTCTTCGAGGGACCGCAGCCGATGGAAGAATCCATGCCAGCTGTTGACAATGAAAGTTTGCCTGATGCATCAACTTCCAGATTTACATGGAAGATTGAA
AGTATATCCAAGCACAGTGGTAGAAAAACTCACTCTGACGTTTTTGTGGTTGGGGGTTACAGCTGGCGAGTGTTGGTTTTCCCCACAGGAAACAATGTAA
ATCACCTTTCAATGTATCTGGATGTTGCTGATGCTAAGTCTTTACCTACTGGCTGGAGTAGGAGTGCCCAATTTAGCCTTGCTGTGATCAACCAATTAGA
CAGCAAGCACTCAGTAAGAAAAGAAGTAACACATACATTTAATTCTCGAGAAAGTGATTGGGGTTTTACGTCCTTTATGCCTTTAATTGATCTATATGAT
CCTAGTAAAGGTTATATTGTGAACGATCAATGCATCATTGAAGCTGAGGTTGCTGTGCGTAAAATTGTGGATTACTGGAACTACGACTCAAAAAAGGAGA
CTGGTTATGTTGGTCTCAAGAATCAAGGTGCCACTTGTTACATGAATTCGCTGCTCCAGACACTCTACCATATTCCCTACT
page-top