Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26568  (registered. 2012)
Contig Information
Length 1022 bp
Clones alternative view 40 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_PCDAM Anther at meiosis 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 1
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115473637|ref|NP_001060417.1|| Os07g0639800 [Oryza sativa (japonica cultivar-group)]
Score 479
Evalue 2.00E-133
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26568
TTTTTTTTTTGGACTAGAAGTATAAGCTTGCGCATCTCCCGATACCGTAAGCTTTACCAGTACAAAGCATAAGTTTGCAATCCCAAATTCAGAAGACAGA
CAGAAGTAACAGCTTAGACAGGCACGCTTTTTTGCTACTGTCAACCAAGAGTACAGCTCAAGAACCACACCGCACTGCATGCCCTTTTGATCATTTAGAC
ATAGCTGTCAATCAGCGACTTCCTCATGTCATCGACGATCGCTGTGGGCTGGCCTTCTCTCAACTTGAAGACGCTCTCGATGACGGACAGCTCGGTAGCC
GTTGTGTCTGAGCCACAGAAGGCGGTCCAGTCGTTCACCGTCATGCCCGCAGCAATGACCTCGCTACCACGGTTCACGGTTCCAGCGACAAGAGGGACTT
GGAGGAGTGTGGACAGCTCATCAAGATCTTCAATGGATGTGTGAGGATGGACCAGTCCACCCCTGTTAGAGAATGCACAGTAGCTGCCAACAAGGATATT
TCCTGCAATCGTCTGACGGAACACCTCAACCCCAAGCACATCTGCAATAAGCTCCTCAGTTGCCTTGTCAAGGTCAGGGTGTGTGAGCGCAACATGGTCA
TTGCAGGATATGCAATTGCCAAGGGCAGACAGCCTCTCATCGATGCGCTGAACAACCACTTGATCAGGTATGCAGTTCCTCAGATGCTGAAGCTCTTGAT
CAGTGGTTGTGTGTGGCAAGAGAAGTCCATTCTTGTTTCCAACGCAGAGGCGACCAATTATTCTAGTGCCACCGATAGAGGTCTTGACCACAGGAATGAC
ATCTGCAAGCTCAGACTCAAATGTACTGTAGAAATTCTCTGATCCTCCAATTGCAACCAGACAGTAGGCATTTGTGAGCTTGGAGAAAACACCAACTTCA
CAGTTGTTCTCAAACTGGATACGGGTCGCCATGGTCGATTCCTCTTCGCCTCAGCCGCTTCTCGTCTGCAGCAACAGGCGCGCACCGGGAGAGGGGCGGG
GGTCGAGAGGCGGTGGCCGCTG
page-top