Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26518  (registered. 2012)
Contig Information
Length 530 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
WH_XA Root 3
WH_XB Root 1
WH_XF Seedling, infected with leaf rust 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig26518
AAAAATTGTTGGATGAAAGTTACACCACGTTCAGATTATTCATGGTGGCTGGGCAGCGCAGCTCCTTAACCTTGCCAGCCTTACAAACTTGGTCTCAATT
TATCGTCAACAACATACTTAAAACAGATTGCGGTAAGAAAATAAAGCTCGGATGAAGTTTAATGTGCCGGTGCTGCTGCTGGCGCTGACCCCGCCTCGGT
TTTCACTTCTTTTTTCCCGCCAAACACCTTCAATCCACCATATATAATAGCGCCCCACATCGCTAAGCTGGTTAGCACAAAGTGCTCTTCCTTCCAGTTG
CCGGGGTTCAAGGGCTCCTGCCACATGTTCACCTTTGTCGATCCGTGGTGATCTGCGGCGCCGGCCATACGGCGGCTGGAGATGAGGCGAGCGAGGGGGG
AGGAAGACGAGGAGGAGGAGGAGGCCGCCGCAAGCAGACGAGACGCCATCGCTTCGATTCGACCTACTTTGGGGCGATGTGTCTGGAGAGCGCAAATCCT
CTAACCCTAAATGGTGGTGGTGGTGGTGGA
page-top