Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26509  (registered. 2012)
Contig Information
Length 851 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 3
Wh_h Spike at heading date 3
Wh_r Root 2
Wh_KMP Shoot grown under continuous light 1
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|239923157|gb|ACS34908.1|| lipoxygenase 2 [Triticum aestivum]
Score 423
Evalue 1.00E-116
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26509
CACCCAAAGCAGAGGGAACATCACAAACATCGACTTTATTATTGGGCAAATGAAGGGAATTTTTCTGTACACGACGACGCACCGCATGCCGATCGGACCC
GTCGTGCACACACGCATTATTGCCTTATTATTGTGGTCATGGCAAAGCATATGCACCAGCAGAACACCCACACTAGCTAGTATCCGGTGCAAGCAAGCAA
GCAAGCAGGGATGGAGCTCCTCAGATGGAGATGCTGTTGGGGATGCCCCTGGCCGTGAGCCCCTCGGCCTGGCCCGTGTGGTCGGAGGTGTTGGGGTAGA
GCAGCATGTAGGGGAACTTGGCCGGCCCGGTGCGGTTCTTGAGCCGCGGGTCCCCGTTCATGGCCACCACCTGCTTCTCGATGCCCTCCAGCCTCGCCCC
GAACCGCCTGAACGCCTCCTGCGCCTTGGCGTCCGACGTCCACGCCGGCGTGTCGTGCTGCCCCAGGTACACCTCGTCGGAGGAGTGCTTGGACAGGATC
TCCATCAGCGAGATGCCCACCAGCGCCTGGAACTGGTTGGTGATGGTGAGGATAAAGGCCTTCTCCGGGTCGCGCTCCAGCAGGGCGTACTCCTCGCTGC
CCGGCGCCGGCATCGGCCGCCGGCTCGCCGACGGCTTGTTGGGGTGGTACCCCGAGTAGGGGTACTGCCCGAAGTTGACGGCCGCGTGGAGCGCCGACCC
GGTCCAGATGATGGTGGCGCANNCCTTGATCAGCTCCGCCACCGTCTGCATCTTGGGCCACCACGCCGCGTCCTNNNNNNCGCCGTGCCCGACCTCCCGC
ACCTCCTTCCACCACGCCTGCAGCTCCACGTCGCCCTGCAGCACGCCGTCG
page-top