Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26485  (registered. 2012)
Contig Information
Length 939 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 3
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 2
WH_XF Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242091283|ref|XP_002441474.1|| hypothetical protein SORBIDRAFT_09g027540 [Sorghum bicolor]
Score 361
Evalue 6.00E-98
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26485
ATCAACGGATTGATTCTGAAAACTCAAGGACTAGATCTACTTCGGTCCAACAACGAACCAAATCGCGCAATTTCATTTGTCTTTACAAGAAACATATACT
ACAAAACAAGAGTTCTACTAGTACCTACCTACCTACAAGGTGATGTCTCTCATGGTGGTGCGTGCCTGGCCCCATCCCCATGGTGGTCGTATTCAGTTAC
CAGGCTCTGCCGCTGCCAGCCTCCATGTTATCCAACGCTCGGCCATTGGTTCTCATCTCCATGGAGGCAACATGTTGTACCATGGACGGCAGCACCGACT
GATGGGGATCTGTTGTTCCTTGGTTCTCAGTTTCCGGGTTAGGATCCTGATGCCGGAATGCATGAGGCCACAGCCCGTGTTTGCTAGCCGGATGCGGGAA
GAACTGCAGATAGCAGAACGAAGCAACAACCAGCCCGAGGATCCCACCGGCAAACACGTCCTGCCAGTGGTGCCAGTAGTCTGCGACCCGCGACACGCCG
ACCATCGCAGCGAAGAGCAGTGGCAGGATCACGACACAGAGCTTGGCAATGTGTCCGCCCCGGTCAAACACCCTGATCTTGCCGGCAAGGTACCACGACA
GGAAGCCCAGCCCGGCAAAGGACCATGAAGTGTGGCCACTGGGGAAGCTCTTGTGCCCTTCTTTGATGACTTTTGCGTCTCCGTGGCATATGACTTGTCG
AGTGACCGCCTCATAGTTCGGCACTCCGTCAGGAAAGCATCGATAGTAGAAGTTGGGGCGAGGCCGGCCGACGCCGTCCTTGATCGCATCGGTGAGGACG
CCGGTGATGAGCACGGAGAACAGCAGGCCTAGTATGGCGTGATGCAGGTCGTAGGCATTCTTCTTCTTGACATAGATGGCGGCGAAGATGAGCATCGGCA
GGATGACGGCGTATATCGGGACGGCCCAGACGGGGATGG
page-top