Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26468  (registered. 2012)
Contig Information
Length 550 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig26468
GGTCTCCTTCCCTCCCTCCCTATCGTCTGTTTCCTTCGGCCGAAAAGCTCCCCTGTTCCCTGCCCCTGCTCCGCCCCTCCTCGTCCCCGGCCTCCGCTCC
GCTCTCGGTAATTGGATGGCCTCGCCTACGACGCCGACGAAGTCCACCGGCGCCCAGGAGGAAGCCGCGGCCCGCCAGTCGCTCATCGGGATCTCCCAGT
CCATCCCGGCGGCGGGAGAGGCCCTGAGCGTCAAGTCGCCGAACGGCCGCACGGAACACGGGCAGGACGACAGCGGGGCGGCCGACAAGTCCAGGTCGAT
GCTCATGTCCATCTCCAACCAGTCGCCGGAGGCGCGCCAGCCCACGCCGTGCCCGCACAGCAATGCCGCTTAGGTTTAAGCTTGATCTTAGTCCTGTAAT
AGTACTGATTAGCCCTGCAGCTGCAGCTGTCGATATGTTGCAGGCTCTTGTGTGGCGCCCCTAATAATCGCCATGTTCCTGGGTTTTCGGTGATGAAATG
ATATGCAGTCTGGAATACTGATTACATAGTTATTACCTGCATAAAAAAAA
page-top