Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2646  (registered. 2012)
Contig Information
Length 749 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_KMP Shoot grown under continuous light 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115457964|ref|NP_001052582.1|| Os04g0376500 [Oryza sativa (japonica cultivar-group)]
Score 412
Evalue 1.00E-113
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2646
CCCGCACATCCACCCCTCTCCGTCCTCCTCTCCTCGCGCCGTCCCTCCAGTCCCTCTTCGTGCCCCCGCGCCGCCGACCACCGAGCAGCCATGGCGAATC
CACTGGCGGCGGGAGGGAAGTCGTTCCTGCAGGCCATGTCGACGGTCACCGAAGAGGCGGCGGTGCCGCTCCGCGTCGTCCAGATGGAGGGACTGGCTGT
CCTGAAGATCATTAAGCGCTGTGAGGAGTTTGCGCCTGCTCTGGTTACAGGTCAACTGCTTGGTTTGGATGTTGGTAGTGTTCTGGAAGTGACCAACTGT
TTTCCTTTCCCTATAAGAGAGGACGACGAGGAAGCAGATGCAGATGGTGCGAACTATCAGCTTGAGATGATGAGGTGCTTGAGGGAGGTTAATGTCGACA
ATAACACTGTTGGATGGTATCAGTCCTGCTTGCTTGGATCTTTTCAAACCGTTGAGCTGATTGAAACATTTATGAACTATCAGGAGAACATCCGGAGATG
CGTGTGTATTGTGTATGACCCATCTAGATCTAGTCAAGGAGTGCTAGCTCTTAAAGCCCTGAAGCTCACAGACTCTTTTATGGATCTGTACCGCAACAAT
GGTTTAACTGGAGAGAAGCTAAGGGAAAAGAAATTGTCATGGGTTGATATTTTCGAGGAGATACCGATTAAAGTGTCCAACTCGGCGCTTGTCAGTGCCT
TCATGAAGGAGCTGGAACCTGAGTCACCTGTTTCACAGTGTGACTTTGA
page-top