Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2645  (registered. 2012)
Contig Information
Length 950 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Wh_SHDr Shoot grown with dessication 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115451383|ref|NP_001049292.1|| Os03g0200800 [Oryza sativa (japonica cultivar-group)]
Score 367
Evalue 1.00E-99
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2645
TTTTTTTTTTGCAACATCTAAAGACTTCTGTAAGTTGTATAGGCTTTTTTTTGTAGCAGCCCAACAGAGCACACGCGTCCAAATGCCAGATGCAGTCAAC
CAACAGATTGCTAAAACAGGTTACACAATTATCAATTATGAACACATAATCTTCCTGATTAAGACCTCTCACATAATTTACAGCCCCAATGCTAAGTAAC
ATGCAAAAAACAGAGAGAGAATCTGCAGCACTTCAAACGCAACAAATCTTGGATCAGTTCTTCTTCTTTGAGTGCTTCACGAGCCAGTCGATGACGGAAT
CAATGTTGGTTGAGTTCTTGCATGATATCATGAAGCAGGCCACTTCTCGATCAGTCATTGCCTTCAGACCCATCAATTCTGTGAAACTTTGCTTGGGGAA
AGCTTCAGGCTTGTCGATTTTGTTGCCAATGACCAGTAATGGGATACCGGTCAAAGATGGCTTGCTCAGAAGGTCATGGAGCTCACTTTTGGCAATAGCC
ATGTTCTCCCGATCTGCTGCATCAACAACATACACAATTGCAGAAACAGCACGGCAGTATCTCTCCCACATGCTCCGGAATCTTGGCTGGCCTCCAAGAT
CCCATAATTTTATAGTGACATTTCCTTTGGTTACCTTTCTCATATTGAATCCTACTGTGGGAATCATGTCTTCGCTAAAACCTCCTGTAGCAATAACATT
CACAAGCGAAGTTTTCCCAGCATTTTGGAGCCCAATCAATGAAAGCTCCATTTCTTGCTTGAAAAAGAGGCTGCGGAGCCAGTTGAGGAAGGCCTCCCAG
AAGCCCATGGCGGCCGCGCTCGGCGTGCTCCCTCTCCTCCGCGAAGAGGAAGGGCTGGACGGTCGCGCGGAGGGGAGGCGATGGCGGGAGGGCGAGGGCG
GGTTGCGAGGCGGAGGAGGATTCGGTGGTGCGGGTGGCCGCGCTTACTTT
page-top