Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2640  (registered. 2012)
Contig Information
Length 578 bp
Clones alternative view 27 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 1
Wh_r Root 3
Wh_SH - 3
Wh_KMP Shoot grown under continuous light 2
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 5
WH_XD Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig2640
TTTTTTTTTTGAAGAAGAAATTCAGGCACCAAATCAAGGTGAGTGGATTCAGGCCCGCACTCGGAGAATAATCAACGGCACGCACATCGATCAACACGGG
TATAATTAACAACAAGATAGACTTGCAACAAGAGAATGACTTTAGCTTTACAGTCCGATGGAATTCAGCAGAAATTGAGATTATTCTTCCACCCAACCCA
ACACGCATCAGTCAGAAAAATCCAGACACCAACCAAACGCCTACCACCACAGTAGCAGCCACTTGCCTGCCTTGAGCGCCGCCGATCGAGGTCGAGGCTC
CCACCACCGCACCACCACCATGATGCCACGTCAGTAGCACGGGACGACGACGCAGCGCCTGCGCCGGGGCTGCGGCGAGCAGACGACGAACAGCAGCATG
ATGACGAAGGCGGCCATCACCAGCGGCAGCAGGTTGAACCCCGCCTCCTCCTCCTCCTGGCTGCAGCACATCTTCCCCATGGCCGATCGCCCGCTCGCTT
TTCTCACAGACAGAGCAGTTTCTTGGCTTGGAGGAACAAGGAGACTGGGCGAGGAACAAGGGAAGAAGTCCTTCTTTC
page-top