Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig264  (registered. 2012)
Contig Information
Length 1677 bp
Clones alternative view 66 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 2
WH_XR Roots, 18 day old plants were grown hydroponically 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
WH_XB Root 13
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242092388|ref|XP_002436684.1|| hypothetical protein SORBIDRAFT_10g007010 [Sorghum bicolor]
Score 629
Evalue 3.00E-178
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig264
AGCAATAACTGTTGACGTGTACAACCTGTCGCTAATACTCTAGCTGACCTGTGTGCCCGAACAAAACAAGAGCACTGCATGACTTATCTCAGAAGGCCAA
GGAATGATTTTGCAAGCACGAAGAAAAGAAAACTACTACACACCCATTCAGAAACTAACACACAACATGCCACGATACCAACAGCATAGAGAATTGGAGG
TAAACAGTAGTATATGGGAATTCCTCAGTACAGGTGATGGCAAAACCTGCGCTCTAACAGCCTTGCTGTCCTAAAACTTATTATGTCAAGCATCAAACTT
CCCGGGGACAAAAAAGGCCTATTTCGCCTGCTTAATGAGTTCCTCTCATCAAAATGATGACACAATAACCATCTGCTACAATAACAAAAGATTTCGGTTG
CTAAACTCAAGTAATTGATAGAGTCCCCATCCACCAATACCCCATCATCCGGGAATACATCGTCATCGTCGTAGCAGGAAAAATCAATCAAGCGATGGCT
TTCGCTGCTTCCTCTACCGGAGCAACTGGTGGAGCACCGCCGGTGGTCGGGAGTCCGACCATGACCTTGAAGGCGTCATAGATTCCCCACTGAGCACCGG
TAAGAGTACCGATCATGACGATGCGAAGGGGAAGTCCTCTGGTGAAAAGGCCCAGCATGCCAATCTTCTTAACAGCATCACCCACTGTAGCACCCTTGGC
ATTGTTGAGGAAAGAGACCAGGTTGTCAGCCGGGTGAGAAACAATAGCACAGAAGACACCGGCAATGTAGCCACCAGCAAAGCTGATACCCAACTGGGAA
GACTTGCTGCACTCGGCCTTGGGAACGGGAACAGCATGTTTGTAGATAAGCTCAACAATGGTCTCAAAGGAAGCAAACTTCATCATGGTGTAAGGAATCT
GGCGACCCCAGAGAGGAACAATGCCCTTGTAGAGCCCAGCAGCTCCCTCAGCTTTGATGAACTTGGGAAGCCCATCACTCAACCCACGAGCAAATCCAGG
CTGTGTCTGCACACGGACCTTGACAGCTTCAAAGGGGCACAGAGCGATATCAGCAATTACCTCAGCAGAAGCTGACCCTGCAAGGTAGATCAGGGTCTTG
TACTTCACGGCATTCTCAGGCCCAGCCATATCTGAGTAGGTCTTCTTAAAGAACTCATAGAACCCAAACTTGCAAGCCCCCTGAGCACTGTAACCAAGCA
AGGTAGGCACCCATCCCCTGAAGAATCCCCTAGCTCCTTGCTCCTTTAACAGAACACCAAATCCAGATGTGATGCTCTTGTATTTCGCGGGGTCAATCTG
CATGTTGCACTTGACGAGGTCGAGCGGGGTGACGGCCATGTGGGTGAGCCCGCAGCTGGCGATCCCCCCGGCGGTGCAGGCGGCGTAGAAGGCGGGAGAG
TACATCTCTATCTTCTCGTTGGGCGCGCGGATCGAGAAGGGCCTGCCGCCCCCGACCCCGCCAGCGCCGACGAGACGAGCAGCCGGGGCCGCGGCGGGCG
CCTGGTAGGGCGACGGGGAGGAGGGGAAGCGCGGGGAGGCGGCGGCGGCGAAGGAGCGCGGGGAGTAGAGGAAGCTGGGGAGGAGCGAGTCGCGGGAGAG
ATCGGAGAGCGCCATCGCCGCCGGGCCGGGAGATCCGGGCGCGGATTCGCGGGGGGCTGCGGCGCTGGCGGTGCTTC
page-top