Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26399  (registered. 2012)
Contig Information
Length 1497 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125542923|gb|EAY89062.1|| hypothetical protein OsI_10547 [Oryza sativa Indica Group]
Score 692
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26399
TCCTCCGAACCGAATGAGGCCTTGAGGAAATTCTAAAGACCAAAGGTGTCTAAATTAGACATCCCTTATTTGTACAACTAGCAACATCCCATTTTACACG
CAAGACACTATTGTACACAGACAACACTGGCATTTATTTGTCTACATGTACCACATAGAGATCTCACACGACATGATACATCGTCGAAACCACCATCCGC
GACCTAATTTACTAGAGTACACAGCCAGTCTCACAAAGTCACAAGCAAAGCAATTTTTTTCTTCGAAAAATTGATGAGCAAAGCACTTACGGGTGCAGCT
TCTTAGGAAGAACAGCGAGGTCGAGCTTGCTGCCGTACATCTTGGCCAGGGCCTGCCCGCACCAGCCATGGCCGTCGTCCAGCGTGGGCATCCTCACCTC
CATGAACGGCGGGGTGGCCTCGCCTTGCGGCTTCACGACCCCAGCGAACACCCTGAGGACGTTGCCGGCGTCGATGTCCATGCAGGCGCTGATCTCGACG
GCACCCTTGGGCGCCGGCGGGATGCCGGTGATCTTGAAGTACCCCAGGAGATGGTTCTCTTCCGCCTGCTCCCCCTCGCCTTCGTAGACGGCGATCAGCG
CCTCGGCCTGGTTGTCCTGCGTTGTTGTAAACAGCATGTCCCTTCTAGCCGGGACAGCGGTGTTCCTTGGAATGATGGCTGCAAAGCCGTCCCCGTCGGC
ACGGATCCCGAGGTTCATCGGGGTCGCCTGAATCGTCAGCAGATCCAGGCTCCCTGAAGGGTCGGTGACTCCTGAAGCAATGGCTCCTTCCAGTGCAGCA
CCTGAAACAGCGGCTTCAAGATCGTCGATGCTTCCATAAGAGTCTCCCTTCTTGCACAATCCCAGGACAAGGCTTCTGATCTTGGGAATTCTGGAACACC
CTCCAACCAAGATCACATCGTTGATGTCCTCTGGCGTTAACTTTGCATCTGACAGGCATTGCTTGATGATCCTCTCGCATTTCTCAAAGATCGCCTGGTT
CACCTGTTCAAACTCTGCACGACTCAGCAGCTTGGACACTTTCAGGCCATTACCCAGGTCTGCATTGATCTCAGTGCTTTCCTGGGAAGCCAGTTTGTGA
ATCGCATCCTGAGTAGCCATTCGCAGTAAACCCATTGACTTGATCCTGTCCGTGGTTGGACCAGCATTGTCACATAAGCTATCATAGTCGGGTAGAAGGT
AGCGCATTACGTTCTGAAGAATGTCCTCTCCACCAACGGTGCAACCTGCGAGTGCTCTTATCTGAGAAACACCTCCAGCAGTGGCAGACACCGCAACGTC
ACAATAGCCAGCACCGATGTTAAATATCAGGGCGATTTTCTCAATGCCACTTCCCATGTTATCTTGCATAAGCTGCTGCTGCTGCTGAGCATACAAAAGA
GCAACAGCAGTGGGCTCTGGCATAAGCCTCAGCACATGCAGTCCAGCCATTGCACATGCTCTCTCGATCCTGGTCTGCTGGAAGCGACTGAATGCAA
page-top