Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26372  (registered. 2012)
Contig Information
Length 838 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115458044|ref|NP_001052622.1|| Os04g0386600 [Oryza sativa (japonica cultivar-group)]
Score 266
Evalue 2.00E-69
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26372
CTGCGTGTAGGCGGCCGCGAAGATGATGCCGCACGCCCACACCGGCAGCAGTCGGAGTCTCAACAACTTCGAAGGTGGTTTATTTTATTGAAATTGAAAA
TTGACACAAGGAATCCAGGTTTGCTGACACCAAAGCAGCATACATTTACAAACATTTTGTCACGCCGCCTCATCTACAAGTTGCTAAAATCGTCTGCCTC
AAGATAAACGCGATTGCTCTGCCTCATTGCCCAGAGGTACAAATCTCAAATTCTCGAAAGCAAATGGATACTGATCGCTCAGTGGACACCTGGATCCCAT
TTCCATATGCCTCCTGAGAATTGAACAGGGCCGCTCCTTTCTACGGGTTACCACTTGGCATCAATGGTTGGGCTTGAGGGACAGTGTACTGTTTATCTTC
CTGGTAATAGCGGTTGAACCCTAGAGTATCCTTGATCTCCTGAAAAGATGGGAGGCTGGCAGGTGAGGGTACACCACCACCTTTTATGGCGAGTAGAGCA
TCCTCCATTGCACGCATTGCCACCCCAATTAGGGACAACGGGTAGACTACAAGGCTAAAACCAATCTCCTTGAGTTCAGCAGGGGTCAATATGGGAGTTT
TACCACCACCTTCTAACATGTTTGCCATCTTTGGTACCCCAGGTGCAACCGCACAGAATGCCTTCATCTCTTCTATTGAAGCAAGGGCATCAATAAATAG
AACATCTGCTCCAGCATCAGCAAAAGCCTGAACTCTCCATAATGCTTCATCAAGAGAAACAGCTTGACGGGAATCTGTCCTCGCCACAATAACAATGTCN
NNNNCACTCTCCTTCCTAGTGTCTATAGCAGCTTTTAT
page-top