Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26333  (registered. 2012)
Contig Information
Length 1121 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_e Seed DPA10 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|255677563|dbj|BAF20955.2|| Os07g0180900 [Oryza sativa Japonica Group]
Score 650
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26333
CCCGCAGCCGCCGCCGCCATGGCCACCACCGCGCGCCCGCTCGTCTCCGTCAAGGCCCTGGACGGGGACATGGCCACCGACGCGGCCGGCGTCCCGATGC
CGCACGTCATGAAGGCGCCGATCCGCCCCGACGTCATTACCTTCGTCCACAGGCTCGTCTCCTGCAACAGCCGCCAGCCCTACGCCGTCTCCCGCAAGGC
CGGTCACCAGACCTCGGCCGAGTCCTGGGGCACGGGTCGCGCCGTCTCGCGTATCCCGCGTGTCGGCGGCGGCGGTACCCACCGCGCCGGGCAGGGAGCC
TTCGGCAACATGTGCCGTGGCGGACGCATGTTCGCGCCCACCCGGATCTGGCGCAAGTGGCACCGTCGCGTCAACGTCCGCCTCCGCCGCGTCGCCGTCG
CCTCCGCCCTCGCCGCCACCGCCGTCCCGGCTATCGTCACCGCCCGCGGCCACCGCATCGAGTCCGTCCCCGAGTTCCCGCTCGTCGTCTCCGACTCGGC
CGAGGGCATCGAGAAGACCTCCCAGGCCATCAAGGTCCTCAAGCAGCTGGGCGCCTACGCTGATGCCGAGAAGGCCAAGGACTCCGTCGGCATCCGCCCC
GGCAAGGGTAAGATGCGCAACCGCAGGTACATCAACCGTAAGGGCCCCCTCATCGTCTACGGCACCGAGGGCTCCAAGATCGTCAAGGCTTTCCGCAACC
TCCCTGGTGTGGATGTTGCCAACGTCGAGCGCCTCAACCTGCTCGACCTTGCCCCTGGTGGCCACCTTGGCCGGTTCGTTATCTGGACTGAGTCTGCCTT
CAAGAAGCTGGACGAGGTGTACGGCTCCTTTGAGGCGTCTTCCTCCAAGAAGAAGGGCTTCGTGCTCCCAAGGCCTAAGATGACCAATGCTGACCTTGGC
CGCCTCATCAACTCTGATGAGGTCCAGTCCGTGGTGAAGCCCATCAACAAGGAGGTGAAGCGCAGGGAGGCCAGGAAGAACCCTCTGAAGAATGCTGCTG
CCGTGCTTAAGCTCAACCCCTACTTCGGAACTGCCCGCAGGATGGCAGTTCTTGCTGAGGCAGCCCGTGTCAAGGCCAGGAAGGAGAAGATCAACTCCAA
GAGGACCAAGCTCAGTGCGGA
page-top