Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26331  (registered. 2012)
Contig Information
Length 1043 bp
Clones alternative view 36 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_DPA20 Seed DPA20 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_RDr Root of dessiccated seed 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XB Root 3
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115473635|ref|NP_001060416.1|| Os07g0639600 [Oryza sativa (japonica cultivar-group)]
Score 416
Evalue 2.00E-114
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26331
TTTTTTTTTTACTCCAATGATCTGTCAATTTTATTGGAACCAGGTTTTCATGCAAGTTAAGGACATGTAACTGATGGCATGCAAGCCGGCATTTCACACA
CACTCTAAGCATCGTTTTTCTTTTTCTCTCCCCTTAAATACACCCTTTTTGGAGCAAGATCTGACCAATAGGCGCCAATCACCACACAATCTTATTCAGT
CTGCGTCCAACTTTACATCGTCCAGGTCAAACCGCTGACCTTTTAAGTTGCCGTTCCTAGTTCAAGCTAGCAAGAGCTTCGACGAGGGAAGCGACGAAAT
GGATCTGGACCTCCTCGTCGACTGTCGAGAAGAGGGGCACATGCACAAACAGAGACTTGATGCCGTGCTGCTCTGCAAACCGGAGGGAGTGGTAGTACAC
ATAGTTGCACACGAATCTCCCCGCGTCATCCGAAGGCATCACATCGTAGCCTGTCTTTCGGAGTGACTTGGTTAACTCCTTCACTGGCAGTGTAGTCTCT
CTTGTCCGTGAGATGCTTCCATCAGATGGCACAATAGGCACTCTCTGAGGTTTCCACCCAAGCTCATCTGGGCAGCGGAAGGTGGCTTCATTCACAGCTT
GATTCTCAAGAGCAAACCGTGATGCACCACTATTTACCCCAAAGTGGACCCAAATTATTTGCCCCTGAGCTGATGACCCGTTCTCTCTATCTGCAATGGC
AGATTCTAGAACTTTATATAATGTTCCAAGCGCCCCCTGCCCGGCTGTTTCGAGAATTTCGCAGCTTCCAAGTACAAGATTTTTCGGCAACCCTCTCTTT
TCAATGAACGATTTAATGTTGGTCACAAGTTTCTCTGTCGGGTTCTCAGCAACACCATGGAACTTCTTAAATCCAGTAACATGTACAGTCACGATTGAAG
GCCCTTCTGATCCCATTTACCCTTCTCGGGGGGGAACCGGCGGCCCTGGGGGAGGCGAGGGGGCGGATTGGTTCTTCGTGGCAGTGGTTGTGGTGGTGGG
ATNNNNNGGGGAGGGGCGAGGAAATTTTTCCTCGTGCCGAATT
page-top