Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26320  (registered. 2012)
Contig Information
Length 1062 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218196969|gb|EEC79396.1|| hypothetical protein OsI_20321 [Oryza sativa Indica Group]
Score 414
Evalue 1.00E-113
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26320
ATAGCAGCGTCACGTTCAGCTGTTAGCCATGACGCCTCCAGCCCAATACAGTAATAAACACACGGAGACCAACCACGCCATTCCATCTCAAAAGAGAGTT
TGCACTGCAGAAATCTACAGAATTACACAACAGAACAGGACAGAACTGAATACTCTATGCATCTCACGGAAGAGCGATCGGCACCCGAAAAGAAAAAGAA
AAGCTCAGCCACGGATGAAGAGAGGCGTGGTAAATTTTCTTTACAACAAATATACAGGTCCACCTCCATGGACTGAGCAAGATTCGTGACCCCTCATGAC
AAGCCAATTGTTGGGCCGCCACATGCTACGATTCATCTTCACCTTCTCTGTGTAAGACAGATGGAGCAGGCGCCTTCATCGCCCTGTCGCCGCCGTTTGC
CGGAGAAGAACCGGGAGGGGTCGCACCGGACGACCTCCGCGGAGCTGATGGGCTCTCCATGATGAAAATGGACTGACTAGCCGTGCCTGTGCTGCTCCTG
TACGGCGAGGCTGGAGTTGACTTGAAAAGCGGCAGACCGTCTTCACGAGCCAATGGGGACATCACACGCTGACTCTCCCCATTTACCTGCCCTCTGTACG
ACCTCTCCTCTGCAATGTCATAGTAATCAGCGGTCCTCACCTCCTGAGCGAGAGAGCACGAGCAGCAGCACAGCCACTGGAAGCAGTCCGTGACGTCGGG
GTTACGGCAGCAGAAGGGGTTCCCAGGGAGGTTGAATCTCTTCCTCATCTGTATTCTCCAGAAGCCGCCGTACAGCAAACCGAAGAAGCACAGCGCGATG
CCGGTGAGCCCCAGCGCCTCTCGCAGGGTTTCGTTGTTGATGTTGACTGCTGCCAGGTTGAAGATGAAGAACGGAGCCAGGCAAAAGAGCAGGAATGTTG
CAATGTGGACGTACATGTTGCCGAACCCAAGCCTCTGAACATTCCACCCGAAAACACAGCAGCTGCAGAAAATTGACAAGTATGCAATGGTTATGCTGTC
CCAGAAATCTGATAGCCCGCCGACCCACTCAGGCCTGCTCTCCACGAAACCCTCGTGCCGAA
page-top