Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2626  (registered. 2012)
Contig Information
Length 954 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115466604|ref|NP_001056901.1|| Os06g0164100 [Oryza sativa (japonica cultivar-group)]
Score 296
Evalue 2.00E-78
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2626
ACATCAACATCGCAAAAGTAAAGAGAAACCTCAACCACATGTTTAAATAGAAATGACAAAGCACCTAACCCTACCGCAACCCTCGGCAAACTTGGTGCTA
TTAAATACCAGTCATTCTCTACCATCAGCATCAGCAAAACACATTCACTAAAGCTAGCAAGTCATTTGCAGAGACAAGCTTTACAGATAAAACAGCGTAC
ATAACATAACAGAATCTACATTCAGCATTGGCAATCTCCACCACAGGATGAAGTTCCTGACACCTCCCGTGCTTAAACATTTTGCCACGCATAGCAGAGT
TAATAAAAGGAATAAGAAATCCACACAAAATTCCCAGTTATGTTTCCTGCTCTGATCTTTTCCAGAATGGCAGGACAGATCTGCATCAGACCACGAAAAA
ACAACAGCATGCAGGTTGACATTTTCAACACGTTGTTCGGCGCACCTTCATAACAAGTTTTGGGGGGTGTGCTCCATCACAATAACTCATTTCGCACCGG
AAGGGTCTGACTAAATAATATTAATCTTTATCTTCCTAGGCGGTGTTCCAGGTTTTGAGTTGCCGGTTCCAGCTTTCCCTTTCTTATCAGAAGGTTTAAG
GATCTGGAATGAGCATGTTAGTGAATCATCTATGCTCATCATGGCACCAGCATTGTCGAACTCGCCACAATAGTTGGGTGCAGAGAATATGGTTACGAGC
TGACGCTTTGCAAAGAATTCATATCCATCCTCCACCACCTGGTGAGCCCTGCAGACCAAATCTAGATCATGTTTCTCAAGGAACTCTGCAACCTTATCAG
CTCCGAAAGTGTATGACACGCCCCTGTCATTCTCACCCCAGCCATCAACATCTTTATCAGGGTCTGACCATAGCAGATCACAGAGGAGACCATGGTCCGG
NNNATCCACAGGACGGGCAATGTTACGTATCTGGTCCATGTTCTTTAAATCAGG
page-top