Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2621  (registered. 2012)
Contig Information
Length 1287 bp
Clones alternative view 25 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_DPA20 Seed DPA20 3
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 4
Wh_OKCS Seed DPA5 1
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_SP 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|59804097|gb|AAX08057.1|| UDP-glucose dehydrogenase [Bambusa oldhamii]
Score 620
Evalue 9.00E-176
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2621
TTTTTTTTTTAGTAACTGAAGCCACATGTATAATCAACAGGATGAACACCAGTAACATGATAAAGATGCAACAACAGACATTAGCTACAAAGCTGTGACA
ATGGACCAAAGGAATGGCACATCCCAGTGACTATACCATTCTAACACTGTAAACCCCGAAGAAACACTCAAGGAAGAAAAATAAATGACATCTGATTTTC
TGGCACAAGATAAACAGCGACTATAAAGAGAAATAACAAGCTGAATCCCTATCGATAGCTGCTCATGGATTCACCCGAGGCGGATCTCCTCCCTTTATCA
GAGTTTATTTAAGCCACAGCAGGCATGTCCTTGAGCCAACCGTCGAGTGGCTTGCCAATGGAGTAGACAATGAAGCCAATCTCCCTCAGCTTCTCAGAGT
CAACAACGTTGCGGCCATCAAAAACAAAGGCGGGCTTCTGCATGCTGTTGTAGATCTTTTTGTAGTCCAGAGTCTTGAACTCATCCCACTCAGTCATGAT
GCAGATGCCATGGGCATCCTTGGTCGCCTCATATGCATCCCAGGTAACCGAGACTTGCTTTGTAGTGGTGGGGCTCATTGGCTGGAGATGAACAGGGTGG
TCCCAGTCAAATTTGTTCATCGCAAGGTCACGCTGGATTTGGTCTTCAGTCACCTGAGGATCATAAATGCTGATCTTAGCCTTGTCACCAAGCAGACCCT
TGCAGACATCAATAGCTGGAGTCTCCCTAGTGTCACCAGTATCCTTCTTGAATGCAAAACCAAGCACCGCAATCTTCTTGTTCGCAACCGTGTTGAACAT
AGAGGAAACAACACGGTTCACGAACCGGCTCTTCTGGTAGTCATTGATCTTGATCACCTGCTTCCAGTAGTTGGCGACCTCTGGGAGGCCATTGCACTCA
CAGATGTAAACCAGGTTGAGGATATCCTTCTGGAAGCAAGAGCCTCCAAATCCAACACTGGCATTCAAAAACTTTGGGCCAATCCTAGAGTCCTTGCCCA
CGGCATAGGACACCTCAGAAACATTTGCACCAGTGGCCTCGCAGAGGGCTGACATGGCATTCACAGAGGAGATCCTCTGGGCCAAGAACGCATTGGCTGC
AAGCTTCGACAGCTCCGCAGACCATAAGTTGGTTGTCAGAATCTGATCCTCAGGAACCCAATGCGCATACACAGCCTTCAGCGTCTGAACAGCCTTCTGA
CCTTCAGGGGTCTCACGTCCTCCAATAAGAACACGGTCAGGGTTAAATAGGTCTTGGATAGCAGTACCCTCAGCAAGGAACTCCGGG
page-top