Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26198  (registered. 2012)
Contig Information
Length 482 bp
Clones alternative view 25 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 1
Wh_r Root 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 7
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222637229|gb|EEE67361.1|| hypothetical protein OsJ_24645 [Oryza sativa Japonica Group]
Score 137
Evalue 4.00E-31
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26198
TTTTTTTTTTGCTAAACCAATTTAGGATAAGATAATTGATCTCCTTCTCCAGCAAAAGTGAAAATAACACAAAAATCCTCACAGGTTCAAGCACATAGCT
CCCAACATTACATTCCATTCTTGGGACATCAAAACTCTCTTAATGGGGGTAAACAAGGAGAGCCTGCTAACAGTTACTAAAGCAAGATGGATAGAACATT
CCCGCTACTAGAAAAGGCATTGTCTGGCTTGATGCTTAAACCTCCTGGACGCTCAAACCTGGTGGGAGGGACTGCTTGAGCTTGTTGGCCTTGTCGGCGT
CGAAGACGCAGAGCGTGTAGAGGTACCTGGAGCAGCGCACCTTGAACTTGACGGCGTCTTTGGTCCTCTTGATCCGCACCGACCGCGCGTCCTTCCGGCG
CGCCGTCAGCAGGAAGTCCTTGATCTCGTGGATCTGCTTCGGCATGGTGGACGACTGTGCAAACCCGAGGAGAAGGAGGAGG
page-top