Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26173  (registered. 2012)
Contig Information
Length 928 bp
Clones alternative view 98 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 4
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 8
Wh_KMP Shoot grown under continuous light 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 11
Wh_PCDAM Anther at meiosis 8
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XT Roots, 18 day old plants were grown hydroponically 6
WH_SP 1
WH_XA Root 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 8
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226499354|ref|NP_001147027.1|| polyubiquitin containing 7 ubiquitin monomers [Zea mays]
Score 450
Evalue 9.00E-125
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26173
CCAATCTCGTCTCCGATCGACTCCAGGCTCGTCGAATCCCCACCGCCTCAAGATGCAGATCTTTGTGAAAACACTGACAGGCAAGACCATCACCCTTGAG
GTTGAGTCGTCTGACACCATCGACAATGTCAAGGCCAAGATCCAGGACAAGGAGGGCATTCCTCCGGACCAGCAGCGTCTCATCTTCGCTGGCAAGCAGC
TGGAGGATGGCCGTACCCTCGCTGACTACAACATCCAGAAGGAGTCCACCCTCCACCTTGTCCTGCGTCTGCGTGGTGGCATGCAGATATTCGTGAAGAC
CCTCACTGGCAAGACCATCACCCTGGAGGTCGAGAGCTCCGACACCATTGACAACGTCAAGGCCAAGATCCAGGACAAGGAGGGCATTCCCCCGGACCAG
CAGCGCCTTATCTTTGCTGGCAAGCAGCTGGAGGATGGTCGCACCCTGGCCGACTACAACATCCAAAAGGAGTCCACCCTCCACCTGGTGCTGCGTCTGC
GTGGTGGCATGCAGATCTTCGTGAAGACCCTCACTGGCAAGACCATTACCCTTGAGGTTGAGAGCTCTGACACCATTGACAATGTCAAGGCTAAGATCCA
GGACAAGGAGGGCATTCCCCCGGACCAGCAGCGCCTTATCTTCGCTGGCAAGCAGCTGGAGGATGGTCGCACCCTAGCCGACTACAACATCCAGAAGGAG
TCCACCCTTCACCTGGTGCTCCGCCTCCGTGGTGGTCAGTAATTGCCCTATCGTTTGACCTGCTGCTGCTGCTGCTGTACCCTGTGTCGCCTTTGTTCAA
GTGATGTCTCGTTTGTGTGAAGTCGTACTGTGTCTGCTGCTTTAATGGACCATCGAGTCCTGTGGTTTGGTGCAAACAGTTGCAGGTACATCTGTACCGT
TAAGTATGAATAAGTCAACTTTGAAGTA
page-top