Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26097  (registered. 2012)
Contig Information
Length 947 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_r Root 1
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XA Root 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242092470|ref|XP_002436725.1|| hypothetical protein SORBIDRAFT_10g007620 [Sorghum bicolor]
Score 371
Evalue 7.00E-101
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26097
ACAGTTCAGGCATAGTATGTCGTATGACTTGATTACTAAAGTCAAATAGTACATAATGCTGGTGCATGTAGTGGCTTAAACATTTTTCAACACAACACAG
TAGATTACACAACAACCATCCCATATCCTTCTGTGAAATAATGAAACACGGTGCAAGGATTTGAGTTCTCTGGTGACTGGCTTAAGATCGATTGAAGACT
AGTGTTGTCATGTGTTGACAGAACTCCAGTAGAGCCACAACTTAGTAGAAGGGCCTGCGCGGACGGCGGAACCTGGGAGCTCTCCCATAACCACCATAAG
GATTGTAAAACGGTGGAGGATATGGCCTCATGTAGGGGTGGCCGCCATATGGGTTGAATCCTCGGCCCCCTCGGGGCTGCTTCAACCCAGGAACGTTAGT
TCGCTTCGGCGCTACCTTGATTTGCCGACCATGAAGCTCTGACTCACTCAGCTTGACAGCTTCCTGAATAGCTTCTGCTTCAACAAATTCAACGTAAGCA
AAACCTTTAGGCTGCCCAAACTTGTCGGTCAGGATAGTCACTCGGTTGACGGTTCCGCACGAATTAAAATGCTGCTGCACTTCTTCTGGAGTGCATGCAT
AGTCAACATTTCCAACAAAAACAGAACGAGAATCCATCTCTTCTTTTGCTTCAGATGTGGTCGCATTAGGATCTCCGCCTTGCATCTCCTTGGCGACCTT
GGCCTGCATCTCGCGGAGGGCGGCGGCCTCCTCCTCCATCTCCTTGAGACGGCGCTTCATCTCGTCGAGCTCGTGCAGCTTGGCGGCGTCGTCGCCCCCG
GCGCCCATGTCGACGTCCTCGCCGTCGACGGGGATCTCCTGGCCGTACACCTCGTGCTCTTCGTCCTCCATGGCCGCCGCGTTGCTGAGCTAGAAACCGA
ATCTACTCGCCTCGGCCTAACCTAACGCGAGGGCGATTTCCTCGTGC
page-top