Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26081  (registered. 2012)
Contig Information
Length 1655 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115466604|ref|NP_001056901.1|| Os06g0164100 [Oryza sativa (japonica cultivar-group)]
Score 646
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26081
GAACTGCTGGGTATCAGGAGTTCATTGGGTTTATGAATCTCCGAAATACCCAATGACCTATAAACATCAACATCGCAAAAGTAAGAGAAACCTCAATCGC
ATGTTTAAATAGAAATGACAAAGCACCTAACCCTACCGCAACCCTCGGCAAACTTGGTGCTATTAAATACCAGTCATTCTCTACCATCAGCATCAGCAAA
ACACATTCACTAAAGCTAGCAAGTCATTTGCAGAGACAAGCTTTACAGATAAAACAGCGTACATAACATAACAGAATCTACATTCAGCAGAATGGCAATC
TCCACCACAGGATGAAGTTCCTGACGCCTCCCGTGCTTAAACATTTTGCCACGCATAGCAGAGTTAATAAAAGGAATAAGAAATCCACACAAAATTCCCA
GTTATGTTTCCTGCTCTGATCTTTTCCAGAATGGCAGGACAGATCTGCATCAGACCACGAAAAAACAACAGCATGCAGGTTGACATTTTCAACACGTTGT
TCAGCGCACCTTCATAACAAGTTTTGGGGGGTGTGCTCCATCACAATAACTCATTTCGCACCGGAAGGGTCTGCCTAAATAATATTAATCTTTATCTTCC
TAGGCGGTGTTCCAGGTTTTGAGTTGCCGGTTCCAGCTTTCCCTTTCTTATCAGAAGGTTTAAGGATCTGGAATGAGCATGTTAGTGAATCATCTATGCT
CATCATGGCACCAGCATTGTCGAACTCGCCACAATAGTTGGGTGCAGAGAATATGGTTACGAGCTGACGCTTTGCAAAGAATTCATATCCATCCTCCACC
ACCTGGTGAGCCCTGCAGACCAAATCTAGATCATGTTTCTCAAGGAACTCTGCAACCTTATCAGCTCCGAAAGTGTATGACACGCCCCTGTCATTCTCAC
CCCAGCCATCAACATCTTTATCAGGGTCTGACCATAGCAGATCACAGAGGAGACCATGGTCCGGAATATCCACAGGACGGGCAATGTTACGTATCTGGTC
CATGTTCTTTAAATCAGGTGATAAACCCCCATGCATGCACAGGATCTTGTCATCAATAAGTGCAGCCACAGGAAGGCAGTTAAAACAGTCAGTAAAAACC
TTCCAGAGACGAACATTGAACCTCCTCTTGCATTCATCAAAGAATCCATAGATTCTGTTGATAGAGGCACATTCATGGTTTCCCCTAAGGAGAAAGAAGT
TCTCCGGGTACTTAATCTTGTAAGCAAGGAGAAGGCATATCGTTTCAATACTCTGTTTGCCACGATCAACATAGTCACCCAGAAACAAATAGTTCGCCTC
TGGTGGGAAACCACCATACTCAAATAATCGAAGAAGATCAGAATATTGGCCATGGATGTCCCCGCAGACTTTGATGGGGGCCTCGAGCTCGAGGAGGTTG
GGCTGGCTGAGGAAGACGTCCTTGGCGGCGGCGCAGAGGCGGCGGATCTCCGCGTCGGAGAGCTGCGCGGGGCGCACCGTCCGGCCGCCGCGCGCCTCCA
GGAGCCGCCGGATCACGTCGTCGAGCGCCGCCGCGTCCATCGCCCGGGCGCCTCGGTGGGGGTGAGGGTAAGCCCTGGTCGGGCGGCCGCGGGGAGCGGT
CGGGCGGGGCGGCGGCGGCGGCGGCTGGCTGGATAAACCCTAGCCGCGCGTGCCT
page-top