Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig26048  (registered. 2012)
Contig Information
Length 773 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|157100083|emb|CAL44728.1|| glucose 6-phosphate dehydrogenase [Hordeum vulgare]
Score 276
Evalue 2.00E-72
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig26048
GAACACCGGCATCGGTAAAGAAGCAACAGCTTCTGCAGTTACACAATCAGCAGTTCCAATACAGCAGCCCAGCCAGACAACCAAATGAGCCGATGAACAG
CCAAGATGAATGAGCTTTCTGCTCTCGGCTTCGCCTCTTAAGAATCACAGAATATGTAAGCCAGTGGTACCAACAAATATATTCACGGTCGATCGATGAA
CACAAGCATCGCCAACCGCTCACACTTATTCAGATCTGTTCCTTGCACCACTCCCACTAGCTGGGCATGCAATGCAAGGCCTTTTGCACAAATTGCGACG
GCAGCAGAATCAATCGCCGCCAAAAACAGAAATCATCACCTCCCGTGTGAAACCACGCTCTCTTCCTAGTGTTCCGAGCCACCCAGGTCGCCCCATCTCA
CGTTGTACTTCGCCGCCAGGTAGTGGGCGCCCACGGGCCCGCGGCTTCCATAGGGGTACAGCTCAGGGGCCATCCGCTTCTGCTCCAGTTCCTTGAGGAG
GGGCGTGAAGAGCTCCCACGCAGCGTCCAGCTCGTCCGACCGGATGAAGAGCCTTCGCTCTCCTTCTATCGCGTCGAGCAACAGCCTCTCATAGGCATCC
GGTATCTCCTTTGGGTACCTTGCTGCATAGTGAAGATTCAAATTACTTCTATCTAGCCTCATGCCAAGACCAGGAATCTTGTTGTTAATCTTTAGGTAAA
TTCCTTCATCCGGTTGCACGCGTATCACAAGCTCATTAGTAGCCCTGTCAAGATCGGTTCCAAAAGACCCCTT
page-top