Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig25806  (registered. 2012)
Contig Information
Length 900 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218189686|gb|EEC72113.1|| hypothetical protein OsI_05096 [Oryza sativa Indica Group]
Score 272
Evalue 1.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig25806
ATATGAAATGCATGCACACAACACAAGTGTGACCTACTCCCTCCGTTCCTAAATACTTGTCTAGCCTTGTATTTTACTGGGAACATCTATATACAACTGC
CAAATGAAAGGTCTTGAGCTATGTCGATATGGCACACGCATGAACTACATAAGCTCTGCAAACATGTAAATGCGACACAAACTTGCGGGGAAACAAGACT
GTTATTCACATGCAGCAAGGCGGTGGAGCATCAAACAGCTGAACCCGCAGCAGCCACCGTCTTGTTGAGCAGCTCACGGAGCGTGCCTGGAGAGGTCACC
GGAGGACTGCACTTGAACTCTTGGCACACATGCGCCACCGCTGGCTTCCCCGATGGGCTGCTCCGTGCCATCTGCGCGATGTTCGCATTGTTGCTCTCCC
AGAATGCCATCTCTTCCATGTTGCTGGCATCTATCTGGATCACGGTTCTGTTTGGGTCGTATGACGAGAATGCAGCAGCGACCATGTCTTGAAACTCTGG
AGATGCTTTATTCCCCACCAGCACTACCTGCTTCCTTGACGGGACACTGAGCATGTCTGCTGCGCAGCACATCAGCGGCAATGCTATGCCAAGTTCTTTC
AGTCTAGTCTCAAACACCGCCAGGAGATGTTCAACATTGCGTTTGTAGCCTTCAGATTTTGTAGCATCAAATATACTGGACAATCTGACCATGTTGATCG
CTGCCATCGAGTTTCCAGAAGGCTCTGCGCAGAAGGCTCTGCGCCATCATAATCTTCTTTAACACGCAGAAGGACAGAAGGGTCTTCTCCAGGGGTATTG
AAATAGCCACCCCCTTGTTTGTCCAAGNNCAATTCATCCTGAATGACTTGCAGCTCGATAGCCCACAGAAGCCACTCTATCTTACACCATATTCATAGAG
page-top