Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig25798  (registered. 2012)
Contig Information
Length 789 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 9
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115473877|ref|NP_001060537.1|| Os07g0661400 [Oryza sativa (japonica cultivar-group)]
Score 182
Evalue 3.00E-44
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig25798
TTTTTTTTTTGCTTTTGTTCTTGACCCATTTCTGAACACGGGAGGGAAGCTACAAGGGAAGGGAAATCACTAGCTAGCAAGCAGGGGCCTGCAGTTTGTT
TTCCCCTTCATTTTTCAGCTGTATACACAGATGCAGGGAGAGACTAGACTGAACCCGACTGAACTGAACTCAAGGTTACACTACACAGCAGCAGCGGCGG
CAGCAGCACTCGTTTAGCTCTAGCGAGGCTGGTGGATGGCGCGGCGGGCGGCACCGCCGGCCCTGGGGCTGACGTGCTGCGCTGGCTTCTCGGCGTGCCT
CATCGGCGCCCAGGCTGCTGCGGGGCCGCCGCCCCTCGGCGAGTTCAGGCTCAGCGTCTTGAGCACCGCGTCCATGTCGCCGCCGAACCCTGCTGGTTTG
TAGTGGTAGAAGTCGGGCTGGGGCTGGGGCGACGGCGGGGAGTAGAAGAGGTCGTCGGCGTCGAGCAGGTCGACGGAGTCGTCGGGGAGGAGGGCGGCGA
CGTCGTCCACGTCCACGTTGTCGGCGAGGTCCTCGTAGAGCTGGTGCTGGCGGAACCAGTGGTCGCGGAACCAGGCGGTGGTCTTGACGAGCTCCCACCA
CTCGGGCGAGTAGTCCTCCACCTTCTTGAACGCCGCCGGGATGAACATGGGCGCGTCCGGGTTCAGCGCCGACATCGCCATGGTGCTCATCCTCTCCCTC
CTACTTTTGCGCTGTTTGTCGGTCGGTCGTCGGGGCGGACGCGTCCGGGACGAAATATCTCTCGCGATTATCTGGGTGGAGACGGGTGG
page-top