Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig25743  (registered. 2012)
Contig Information
Length 842 bp
Clones alternative view 48 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VSCB Liquid cultured tissue 3
Wh_VWD Shoot grown with dessication 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|52548244|gb|AAU82109.1|| ubiquitin-conjugating enzyme [Triticum aestivum]
Score 313
Evalue 2.00E-83
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig25743
TTTTTTTTTTGAAAATCCAATCAAAGCATGCAATGGATAGCCACACATATCATAGATACGACAGAGATTTAACTTAACGGATAACGAAACGTCAGGTAGA
ACAGACTACCCAGACCCAACGGACTTGACATGGCAAGAGTACATTCATACGAGTTCAACAGGGGCACGACGGCCTCAAAAGTCCATTCACTTCGTCACGG
GGTGGGGTGATACTTTTGGCTGGTTATTTAGGTGATAACGGTTCTGGCTCGGCGCATCCATGGTCACCAGCTGGCCGTCAAGCTCTAGCCCATGGCGTAC
TTCTGTGTCCAGGAGCGCGCCGTGGACTCATACTTGGCCCTATCAGTCTTGTACATGTGAGCGATCTCGGGCACCAGAGGATCATCGGGGTTCGGGTCCG
TCAGCAACGAACAGATTGACAGCAGGACCTTTGATATGGTCAAAGCCGGGCTCCACTGTTCCTTGAGAATGTCAAGGCAAATGCTGCCGTTGCTGTTGAT
GTTTGGGTGGAACACCTTGGTGCGGAAAGAGACCTTCGGGGGCTTGAAGGGGTAATCCGGTGGGAAATGAATGTTCACCAAAAATAGGCCACCGGTGAAC
GGGCTGTCCGAGGGTCCCATGATAGTGGCCTGCCAGTGGAACATGTCCTCACCTACAGGACCTGCGCTGCATGAGGTGGGAGGGTCCTTCTGCAGGTCCT
TGAGCTCCTTGAGGATCCTCTTGGACGCCATGGGATCAAACCCGACCGGCGGGGGCGACGGGGCCGGCGGTGCTGCGGCGGTGGGCGGCGGCCGCCTCTC
CCCTCTGCGGCGGCGGACGGCGGTTGGGGACCACGGGGCAAG
page-top