Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2572  (registered. 2012)
Contig Information
Length 795 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|255677596|dbj|BAF21061.2|| Os07g0205200 [Oryza sativa Japonica Group]
Score 267
Evalue 1.00E-69
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2572
AATGGCAGCTCATTCGGACCCTACACCAAGATAATGTGAAAACAACCCTCAAGTATATCCTAGAAGCTCCTGGACCATTGACTTCTTGCATCAACCAAGT
GTTCATGTTTCCTATTTGTGACTACTACCTTTTACATATTTTAAAATTAGCTAATGTTACAACAGTGATACACATGTTTCAATGAGTCGCAATGCTCACA
GGCTACATTTTAACAACCTAGTTAATCATAGGGTTCACTGAGATCAGCAAGGACAATGTAATAAGCTCTACAACACGAGTCAGCCAAGTAAACATCTACT
TTGCTACTTAAGGTCAAAAATGAAAAAAATGTGAATTGTATTCCAGAGTGCATATACAGCAAGCTTAGGAGCCTATAGCGAGAGAGCGCCAGACGCAAAC
AATAGATTCCTCCGAGAAAACCGCAAGTTATAAACAGGAGTCGATTTTGTAGGGAGAGCTTTCAGCAGCCTCAGTCGGTTCGTAGAACCAGCCTTGGTGT
CATCCATCTTCAGGGCCTTTGTGCTGGACGCGACATCCCAGAGTTTAACAGTGCAATCAGCTGATCCAGATGCAAGCAATGCTCCCTCGCAGCTGAAAGC
AAGTGACCACACACAAGAGTTGTGTCCTGCTAGTGGTGAAACGCAGCGACCAGTAGAGAGATCCCACATCATGATGGTCCCATCTTCATCTCCGGAGGCC
ATGTATCGGCCATCAGGAGACATTGCCAGGGACAAGACCATACTCCTATGACCAATAAACATCCGTATACATTCACCAGTTTGAACATCCCATAG
page-top