Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2565  (registered. 2012)
Contig Information
Length 1023 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 4
Wh_SH - 2
Wh_KMP Shoot grown under continuous light 4
Wh_RDr Root of dessiccated seed 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_SP 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242087799|ref|XP_002439732.1|| hypothetical protein SORBIDRAFT_09g019170 [Sorghum bicolor]
Score 429
Evalue 3.00E-118
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2565
TTTTTTTTTTGGCTGAAGCTCAAGGATGACTATTGACAAAATGATGAACATTACAACAAACATCAGACAAAAATACATGTGTAAGTGCATGCATAATTCG
CTCATAAATACAAACGACCAACAATACCGCTTGTTTGTTGATCAGGGCACTGTTTAACTGCCGACGTCGGATGTCCGTGAAACTAAAAAAAAACTGTACC
TAAGCACCTCCCAGTGTTCCCCCACAGTCGTGTTTCTCAGTGTGTATTTATCACAAGGGATGGATGGTCAAGCCTGTGAAGTTGGCAGCAAATGCCTGAT
GACTTAATTGGTCGTGGTGACATCTAGTTAGACGAATCTGCGCCATAGTCGAGCATTTCTTTAATGTTCAGCTTGATTGAAGGTCCCATTGATGAGCATA
CATATGCCGTTTTCCAGTATATCCCCTTTGCACCAGATGGCTTGTTCCTCTCAATGGAGCGAACAACAGCCATGAAGTTTGCAATAAGGTCTTCTTCAGG
GAAGTTAACCTTGCCGAAAGGAATGTGCGCAATCCCTGTCTTATCAACTCTGAATTCAACTTTACCTTTCTTGAACTCATCGATAGCCTGAGTAATGTTT
GGAGAAACAGTACCAGCTTTGGGGTTGGGCATCAATCCTCTTGGTCCTAGAATCTTACCCAAGCTGGCAACCTTAGGCATCATATCAGGTGACGCAATCA
ATTTGTCAAACTCCATGAATCCTCCTTTTATTTGTTCAATCAAGTCATCTGAGCCAACAATATCAGCGCCTGCAGCCCTTGCCTCATCTATCTTCTCACC
TTGGGTGAGAACTGCAATTTTCACGGTCTGTCCCGTCCCCTTGGGCAAATTGACCGTGGCCCGGAGCTGCTGGTCGTTGTACTTGGGGTCGAGGTTCATG
CGGAAATGCGCCTCCGCGGACTCGACGAAGCGGGTGTTGGCGACCTGCTTCATGAGCGAGATGGCCATGGGCACGTCGTACTCCTTCTTGCTCTCCCTCA
GCTTCTGTATCTCCAGGTATCTC
page-top