Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig25641  (registered. 2012)
Contig Information
Length 796 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
Wh_VWD Shoot grown with dessication 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115444493|ref|NP_001046026.1|| Os02g0170100 [Oryza sativa (japonica cultivar-group)]
Score 278
Evalue 4.00E-73
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig25641
TTTTTTTTTTGAATACCAACTAATCAGAACAGAGCTTAAATCAGAGATGAAACCATGGCAACAAGAAAAAGGAACTCGAGTGATATACAGATTTCGGATC
TCGCAAGCCCTTGTAGGGTAGGCAAATGCCATTTATTCCATGTTTTGATCCTTTCTGGGCTGAGAAAGCAGGTGGTACAAAGTGCCCAACAGCACATGAC
AAACACCTATGAGTGTCGAAGCGCAGATTCTCTTTCAGAATCCACCATGCTTAATGCTTGCTGTCCTCTTCCTCGCAGAATTTTGAGTACTTCTTGTCGT
CCATCAGTGAGTTGAGCTCACCTGCATCGCTGACCTTGACCTTGATGATCCAGCCGCCCTCATATGGATCTCCATTGACCAATGCTGGTTTCTCTAGTAG
TTCGTCATTCACTGCAATGACCTCTCCAGACACCGGCGAGTTGATGTCACTGGTTGCCTTCACACTTTCAACAGCACCAAAGTTTGTTCCCTGAGATACA
GAAGCGCCAACTTCTGGCAGCTCCACATATACAACATCACCCAAATGGTCCTGGGCATGGTCTGTAATCCCAACGGTTGCGGAATCACCATCAACCTTTA
CCCATTCATGGGTTTCAGCATACTTCAGATCCTTCAGCACGGTGGAGAAGGCCCTGGGGAAGGCGGAGATCTTGAGGTAGGAGGCGGCGCGGGAGGCCCA
GAGCGATCTGGAGGCGGCCATGGCCATGATCACGCGACGGGGGAGGAGGAGGGGATCGCGCTCGCTCGGCGCCGCCTCCTCTGTTTCTCTCTCTCT
page-top