Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig25599  (registered. 2012)
Contig Information
Length 754 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
Wh_VABA Shoot with ABA treatment 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125527181|gb|EAY75295.1|| hypothetical protein OsI_03186 [Oryza sativa Indica Group]
Score 253
Evalue 2.00E-65
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig25599
CACTCGTCCAACTGGACAAGAGCCACGAAACCTGCGTCGGTCGGTTCATGGCGTGCAGCTTCTCCCCTTCCTCCGCCACGCGGCTCCAGGCGGTGGACGC
GGCGGCCGTGAAGAACGCAAGGGTTCCCCTCAAGGCGTCCGTCTCGCCCGCGCCGAGATCGCTGGGCGGCTGCAGGGCTGCCCGCCAGGAATTCGAGGGC
GCGACACAGGATCCAAGCGTCTCAGTTTCTTCGGCACGCACCCAGTTGGATCTCCTGGAGCAACTGACGTCGTCCTCCACACCTAATGGCACCGAGAATG
ACACCGCTACGGAAACCCGTGTGCTCACTACCATCCGTGAGCAGCTGGTAGAGCTGTACGGTGACAGGGGAGGCGAATTCACATTCACCCTCCCGTTGGG
CAAGAGGCTCAGGGAAGGCCTCAAGACCCTCAACACCCTCACCGTCTCACAGAGAAGGAACATCAAGAGGCAAGCCATGCTCACCAAGGTTAGCGGGAGG
AACGACTCGGTCTTCTTCGCGACTGTCGGTGCATTCGTCCTCGTGCCGCCTATCGCCATTTTAGCCATAGCTGTCTTAACTGGTTATGTCCAGCTCTTGC
CATGAATCAAGAGGTTTTTAGTGGTCATCTTCAGACCTTTTCATACACATGAAGGCACTTTGGCTCCGCCAGAGAATTGTATGTCTGTATATATAGTTAG
AATTTGTATATGGAGCATGTAGGTTTTTATCCATTAAGCAGCAGATATGGCATA
page-top