Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig25558  (registered. 2012)
Contig Information
Length 750 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_PCDAM Anther at meiosis 4
Wh_VSCB Liquid cultured tissue 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242035523|ref|XP_002465156.1|| hypothetical protein SORBIDRAFT_01g032870 [Sorghum bicolor]
Score 244
Evalue 5.00E-63
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig25558
CTCAGCAAGATCATAGATGCTCAAACTAGAGCCTTAATCGTGTATCTCGAAGTACATGGGTGTATTACACCTACAGAAATACCTGTCCCAAAGAAGGATT
ACAATATTTATGTCAGTGTTGCGAGACATACTTCTGAGATGTAATCGCATTTTCTGCTGGCCATGAACAAAAGCAGCAAGCTCTAAATGTCCAAATAAAA
TGACTTCAGTCATCATAACAGAAAGATAACAATGCAACCCAGGGCTGACCCAGCATGGGATAACTGTGTTTCCTTCTCAATGGAAGTAACCGAGCACCTG
GCCACCCACATTCTGCCTAATTGCTTCCTCGTGATCTAAAACGCCATTTGGGGTGGTCACCACAACATAGCCCCACTGCCGTGTTGGAAGCATCCTAGTT
CTGTATTTTTCTATTTCTGTAGCTCTGAGGTCCTGCCTGTAAGTGAGAGCTTTGCAATCTTTAATCCTTCCCTGAAGTTCCACGGTGATTTTTCCAACCC
TATGTGGATCGAAGACCTCGAAATTTTTTATGTAACCTCGGTGCTTCATGATGTTGAGGAAGGAGATCATGACGCCGGAGATGGGCTGGAGTTGCGCCGT
CGCCTTCCCCCGCCGCTCCGCGTTCACCATCGTGCGCAGCGCGTCGTTGAGGATCCTCCGCCCCATCGCTCGCTCGATCTCCTCGCCTCTTCCGCTCGTA
GCCGCACCTCTCGGCTCGCCTCTCTACCAGCCGCCGCCGGCGCTCGTGAG
page-top