Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig25544  (registered. 2012)
Contig Information
Length 801 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242076596|ref|XP_002448234.1|| hypothetical protein SORBIDRAFT_06g023750 [Sorghum bicolor]
Score 288
Evalue 6.00E-76
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig25544
CATGGATTTCAGGATGAAGATATGAAGTATAGNNNNNNNGACAAAGTCTTTCGAATTTATAGCGATCCAAGAATAGTAATAGGGATACAAACCACATACA
AATGATATTACAAGCAAAAAAGTAGAAGAACGTTAATAATCAGGAATAGCCAGTACCAGTCTTAAATACTTTTATTAACTGTACACTTCTGTTTCTGGTT
TTATTTTTTCCAATACCTTCTCAGCATCAATAAAGCCCCCTAAGGGACCCAATGGTGTATATTTTACTTGCCTCCAACTGGGTATAAATGGCAGTGCCAG
GCAGTGAAGATGGAGGTGATCAATACTATTAAATGGTGGCTGATGAAAACCAAATCTATGTTCCTCAGATTTGGGAGCATCTCGACTGAGTAAATCTTTT
CCCACCTTCACCATGTGACTAACTAACTGGTGATCTTCGTTGGTTCTTTGGAGATTTTTTACAGTTGGTATATGCTCGATGGGTATGACAAGATAGTGCC
TGAACGCGGACGGATTGATGTCCTGGAACGCGACGACCTTGTCATCGGAGTAGAGGAGAGCGGCGGTGGAAGCGGGGGCGCGGCGGGCGATGTCGCAGAA
GACGCACCAGTCCGCCATCGGCGTCCGTCCTGCCCTCTTCGCAGCGGAGCCGCGGAAGCAGAACGACTTCTTCATGGCCCCCCTTCCACCGGTTGGGGGA
TGGGTAGGTGGGAGGGCGACGCGGAATTGACCGATTCAGCGACGCGCCGGGACGCGGCGGCCGCGCTCGCGGTTGCTTGCCGCCGTCGTCCAAGTCGTCG
G
page-top