Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2554  (registered. 2012)
Contig Information
Length 2331 bp
Clones alternative view 36 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 1
Wh_VSCB Liquid cultured tissue 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_XT Roots, 18 day old plants were grown hydroponically 5
WH_XE Seedling, infected with leaf rust 5
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242061748|ref|XP_002452163.1|| hypothetical protein SORBIDRAFT_04g021010 [Sorghum bicolor]
Score 597
Evalue 2.00E-168
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2554
CACGGTCCATTGTGACGGTGACATTCACTACAACATGTATATCCAAAAATTTCGCCACCCACACTACAACATGTACATATCATATCAATCCCCAACTCTC
CCAGTACCAGGGCTCACCGAAGGACATCACACCAACCCAGTATGTAAACCTGTGCTTTCCTCCACAAGGGGCTCCTCCTGTCCTGCATGCCAATCAATCA
GTTACATCCAAAGCCATGAGTTAATGGTGTGCAATCTGTGCTATTGCACAAGCTCTGGCATCAGCCTCAGCAGGAACGAGATCTCCCGCTGTGTGAAATT
CGGCGTCGATGCGGCATCTTTCACCACCTTGCCGCTCAGATCATTGATCTCTGTATCGGTCTCCGGGAGGGCGATGAGATCAGAGACAGCCCCAGTGATC
TCCGGCACGAGGTCGACGATGACCCCGTTCACCCCCATCAGGTGCTGCATGTACACCGCCTCCGGCACGTTATTGAGAGTGCCGTAAGTTAGTAGGGAGA
GGTCAGCCTCCTTGATCTTGGGTATAGCGGTCGGGAACCTGAAGACGGCGCGGGCCTCGGACACAATCCCTTGCATGCCGCTGGCAAGGCACAGCTTGAC
CGCCTCTTCCAACGAGTTCCTCCTCACGTCGGCGTAGATTTCCGTCCCTCCGTTCGTTAAGAAGTACACAGGGTATGTGCTCTGCAGTTTTCGCATGAGC
TGCGCAGCATCGGGCTGGAAGCTAGAAAAAATGATGGGCCTATCCTTGGCACACTCGAAGACCACCTTGAGGATGGCCTGGAGGATGTGAGTAAGCTCCT
CATCTTGGTACACAAGATTGTCATCGAATTTCAGCTCGACATTGAAGCCCAATCTTGGATTGACCTTCTCGAATGCTTCTTGAAGGGTGCAAAGAGGATC
ATCTGACTGGACGTTCCAATTCAACACCCGACCGTCCTTCATTTTCCGCAGCAAAGGCTTCCCATTCTTGCCTTGCTTGTTTTGTGGGCCATACTGGAGG
AAATCTTCCAACTGAAGATCAGTGACACGCTTCTCTGAAATTTTGCCATGTTCTTCAGTAATGATGAAGTTGTCATGGAAGATGACTGGGCAGACGTCCT
TGGTGACCTGGACGTCGAACTCGACGTAGTCGACGGCGAAGCGCGCCGCCTCGTTGAACGACCGGACCGAGTTCTCCTTCACCTCCTGCATCCGCCGGTC
CGGCGACGCCAGCGCGTTCATCCCCTTGCCGCGGTGCCCGATCACCGCGAACCGCCGGCCCGCGCCCCGCTGCTTCTTCACCATCGACGCCGCCTCCGCG
TCGAGGACCCGCGCGGCGGCGGCGGCGAGGTGGTCCGGCACGACGACGTCGAGGGTGGGGACGTCGGCGACGCGCGCGGCCTTGAGCAGAGCCATTGATC
GGGCGACCGATGTGTTATACGTACGCACGTGCGGCGCGCCGAATTGGTGGGGATGTCGGACAGCGAACGCCGGGCTGGATTCGGCGAGGAGAGGAGAGGA
GAGGGGCTCAATGGCTGGCTGGGCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAGTATGAACCAATTTGAACTGTGAAACTG
CGAATGGCTCATTAAATCAGTTATAGTTTGTTTGATGGTACGTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACCCCGACTTC
TGGGAGGGGCGCATTTATTAGATAAAAGGCTGACGCGGGCTCTGCTCGCTGATCCGATGATTCATGATAACTCGACGGATCGCACGGCCTTCGTGCCGGC
GACGCATCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGGGGCCTACCATGGTGGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAG
AGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACGGGGAGGTAGTGACAATAAATAACAATACCG
GGCGCATTAGTGTCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAG
CTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGACCTTGGGCCGGGTCGGCCGGTCCGCCGTCCGCCACTGAAGCGGCCGCCTC
CGCCTTCCCCGACCGTCCGCCCGTCGATGGCTACTCCTCTACATCTACATAGTACCGCCGCGTAGATCCGTTTAGAGCGCCGCTGCTGTTACCACTTACC
ACTAGCGATTTGTTGGTTGTCAAAAAAAAAA
page-top