Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig25501  (registered. 2012)
Contig Information
Length 1083 bp
Clones alternative view 32 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_DPA20 Seed DPA20 1
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_RDr Root of dessiccated seed 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 2
WH_XB Root 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242084838|ref|XP_002442844.1|| hypothetical protein SORBIDRAFT_08g003720 [Sorghum bicolor]
Score 368
Evalue 6.00E-100
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig25501
TTTTTTTTTTCTTTTTTTTTACTTGTAACCCCAGCATTAACCATTTCACTTTAATTCCATCGTAACGACAAGTTCATATATATTGACAATTAAACGTGGA
ATAAATACTTCACCAACAATTAAACACGAACAAAACGCAATTTAGTAGTAGGAGTAACCAACACTAAATTCTCTTTTCCTTTTTACACCTATACCCCTCG
ACGCTAAGTCTTATTACCACCATGTACCACCCCCCTTGGCCTTGAGCCTTGATGATCCTCTTGGCTACGCGCACGCGCGCGCGCCACCCGCAAGAAACCT
ACCTCGCCGCCGCCGACGGAGCAGAGGAAGATGATGAAGAAGAAGAAGCAGAGCACGTGCGGTTCGGCGGCTAGACCTCGACGTGGCAGTAGGTGGCGGT
CTGGAACCTGAGCCCACTGGCCCCCGGCGCGCCGTTGCCGCCGGCGCCGACGAGGAAGGCGGGGCAGGTCGCGAAGATGTGGTAGTGGCCGGAGATCCAG
CTGCCCACCTTCCACCGGACGCGGCCGTCGATCTTGACCTGGAGGATGAGGTACCCGGCCTGGACGTCCTTGGCGAGCGCGTCGGCGAGGTAGGGCGCGA
AGGGGACGTTCGGGCCGGAGAGCACCGGGGACCAGACCTCCACGTCGCCGTGGCCCTGGTACACCGGCGGGAGCGCGGAGGCCAGCGTGATCTGCTGGTA
CTTGTAGGAGGCGTAGACGTCGAGGCGGTCGTAGTAGACGCCGACGCGGTCGTTGGGGTTGCGGGAGGCGACGGTGACCTGGAGCACGGTGGAGAGCACG
CCCGCGGCGGCGGAGGCGTTGGCGGAGAGCACGTCCAGCTGCCGGAGCGAGGCGTCCTGGAGGTAGAAGCGCGGGTGCGTGGGGCGGAGGACGAGGTAGA
CGATGAGGGCGATGACGGCCACCACCAGGGCCAGGAAGAAGAGGAAGGCCAGGAAGCGCCGGCACGTGCGCCGGATGTCGTCCTCGCCGTGGTTGCCGCA
GTCCTTGCTCATGGCGTCCGAGCTTGCTTGCTTTAGGACGCGTGTGGGAGAGGAGAGGAGAGGAGAGCAGAGGAGAAGAGGGG
page-top