Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig25298  (registered. 2012)
Contig Information
Length 713 bp
Clones alternative view 34 Clones [Download: TSV  ,  FASTA ]
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 14
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 9
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig25298
GTCAGACACACTATCATCACCGACTCAATTTTTTATAAGAGTAAGACAAATGCTTAGCCCAAAGGAACGAGGAACCAAACAGCCACATGTCTATACTGAT
AGCCAAACATCTCATAGTGCAGAGAAGTAAAAACGGAGGTCAACCCAACTAATGAAGGATTATCCTTGACTTAATTTCCGTCGACTTGTTTTGAACAATT
AACAAAAGAACTTGCTTTACACACTCCTCCAAGAGAAGCTGATCGAAAGAACAAACCTACACACACACTCCTAGCTAGAAGAAAGCTGCGGCTTACAATT
TCGTGGCATGGCAAATACAGTAGCAATATAATCAAGAGGAAGTGGCCGCCCCCGCCGCCGCTTTGGGTTTGGGGTGCACCTTCTTCTTCATGAGGCCAAA
GAATCCTCCCCTGCTGCTCGCACCACCAGCCTCCTTCTTCTCTCCAGCGGCCCCGGCGGCGTCCTTGCTGCTCTTTGCGCCGTCGAGCGCCGCCGCGGCT
TCGGCTTGGTCCATGCGCCTCAGCTTCTCCTTGTAGGCGTTCTTGAGCACGTAGGCCTCCACGAAGTCTCCTCCCATCATGGACGCCATGTCTCCTTGTC
CTGAGCACTCGTTGCGCTGCTGCCGCCTGCCGCCGCTGCTTCCTTGAGTAAGCTGCTAGCTACTGGGAGCCTGGCTAGGATGGATGGTGCTTCCAAATTG
CCCTCGTGCCGAA
page-top