Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2527  (registered. 2012)
Contig Information
Length 1078 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
Wh_VWD Shoot grown with dessication 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|138753444|emb|CAM57979.2|| NAC transcription factor [Hordeum vulgare subsp. vulgare]
Score 601
Evalue 5.00E-170
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2527
CTCTTGCTTGCTTGCTTGGCCTGTCCGTTTCTCTCTCTCTCTACTGCGTGTTCCTCTCTCATCGCATCAACAAGGAGAGCAAGAGATAGAGAGAGATGTC
GATGAGCTTCCTGAGCATGGTGGAGACGGAGCTGCCGCCGGGGTTCCGGTTCCACCCGAGAGACGACGAGCTCATCTGCGACTACCTCGCGCCCAAGGTC
ACCGGCAAGGTCGGCTTCTCCGGCCGCCGCCCGCCCATGGTCGACGTCGACCTCAACAAGGTCGAGCCATGGGACCTCCCCGTGACTGCATCGGTGGGTG
GCAAGGAGTGGTATTTCTATAGCCTAAAGGATCGGAAATATGCGACGGGGCAGCGCACGAACCGAGCTACTGTGTCGGGGTACTGGAAGGCAACCGGGAA
GGATAGGGTGGTGGCACGACGTGGTGCGCTAGTGGGGATGAGGAAGACATTGGTGTTCTACCAAGGGAGGGCCCCTAAGGGGAGGAAGACGGATTGGGTG
ATGCACGAATACAGGTTGGAGGGTGCGCATGAGCAAGCTTCCAAGGAGGACTGGGTCCTGTGCAGAGTCATCTGCAAGAAGAAATCAGGAGTTGGTGCCA
CCCCCAGGCCAAGGAACCTCAGCAACATTGTCCATGGCACACCCACAGACACCTCCTCACCACCACTGCCACCTCTCATGGACACCACCCTAGCACAGCT
CCAGGCCACCATGAACACCTCCGCCGCCGCCGCCGCCGCCGCACTTGAGCAAGTGCCCTGCTTCTCCAGCTTCAGTAATAACAGTGCCAGCAACAGCAGC
TACCTCCCCATGGTGACAGGCAACAGTAATGGCATGGGCTACATGGACCATGGCCTGCCTGACTTTGGGAGCTACCTAGACCCCGCCATGAACTGTGACA
AGAAGGTCCTTAAGGCAGTGCTGAGCCAGCTTAGCTCCATGGGTGGTGAGGTGGTGCCGAGCATGTCTCCTCAGATGGCTGCTGCAGTGAGCTCTACTTG
GAACCACTTCTAGGCAAATTTGTTTATTTATGCAGACAACATAAGCAGACAACTGGCTAGCTAGTAGTTAATCTGCAG
page-top