Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig25240  (registered. 2012)
Contig Information
Length 787 bp
Clones alternative view 162 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_SH - 9
Wh_EM Dormant seed with water absorption 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XN Leaves, plant was grown at constant 23Ž 46
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 8
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 8
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XE Seedling, infected with leaf rust 6
WH_XF Seedling, infected with leaf rust 8
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 12
WH_XV Leaves, plant was grown at constant 23Ž 9
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 17
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115486573|ref|NP_001068430.1|| Os11g0671000 [Oryza sativa (japonica cultivar-group)]
Score 189
Evalue 3.00E-46
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig25240
TTTTTTTTTTTTTTTTAAAAGGAAAACTTGCTCTGAGGCTGTTATTGTCTTTACCATAGGTGGTTAAACATTGAGAAGACCACACCACACACACGAGAGA
ATTTACACACGCATGGAGCTTACACAGAGCACACACATACACCCATCACTCGCTAGCATGCAGCGAGCATACCGAGCCAAGAAAATAAAGTTACAAGCAC
TAGTAGACAGTAGTACGAAGCTGAAGACAAACCACATGCAGCCTCGGACAGCAACGTACGCTACGCAGGATTAGATAACCAAAAGAGCAGCAAACATGGC
GGCGTCGCACAAGTTGTTGAGCACCCTGCCTTCAGTTCTCTGGCCGACGGCTCTTATTTAGCGGTGGTTGCTCCTTGTCCTCGTCTCGTCGCTGTAAAGC
CAGTCGTAGACGGTGGGGGAGTTGGGCTGCGGGCGGTCGAAGAGGTTGGCGCCGAGGCTCTTGGTGGCCAGGTTGCTCCCGGGGTGGAAAACGCTCCGCC
ACACGCTGCCGCCGCGCGGCGGCGTGGACGACGACGGCGTCACCGGCGTGGTCGGGGTCGTCGGCATCGACGGCGACTGCTTAATCGCCTCCCCTGCAGC
TGTGTTGATGGCGAGGGGTTGGGTGGCGGCGGCCCGGCGGAGCTTGTCGAGGCCCGTCTCCGGGCGAGGCCCGGCCACCACGTCGTCCCACAGCTTGTCC
AGCATCCTGTGCAGAAGTTGGATCTGATCGGTGCAAGAACTAGTGTCACTCGCTTGTAGCACTACCACCGATAAGATCAAGTGCACG
page-top