Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig25176  (registered. 2012)
Contig Information
Length 488 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig25176
ACAAAAGACTTTGTTCCTAATTTTGCCAGATCATCCAACGCCCCCAGCGTCTGGTACAGAAGATCGTTACCCGTCCGCCTCCAAACTGAGTGATCAGAAA
ACCCAACCAACCAAACTTCGCAACTCAATCAACCAACCACACAGTTCAAGAACCTTCCGTTACCACTGGTCACATGAAGAAGGCCCCTAGATTTTCACGG
ATGAAGCTAGACGCCCGACTGCCCCTCCGTCGAGGGTTCCCTCTTCTTGTCCGGGCAGAAGACGAAGATGGCACCAGGAATGAGGACGTACGACAGTCTC
TTGTGGAACTGCTCCCTGCGCTCGAAGCGTCTCTCATGTTCTAGCAGAATACCAATATCCTTCTCCATCACGCACAAGTTCTCAGAAAACTTCTCCAGGG
CCGCCTCCATGCGCATGTGGGCCACGCAGCACGCCTTGGGTTCGACGACCCCCCCAGCCCCAGCACTGAGGAAGCGGGGGCACTCGAC
page-top