Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig25168  (registered. 2012)
Contig Information
Length 2684 bp
Clones alternative view 288 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_h Spike at heading date 2
Wh_r Root 1
Wh_DPA20 Seed DPA20 1
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 6
Wh_SHDr Shoot grown with dessication 3
Wh_VWD Shoot grown with dessication 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 6
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 14
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 13
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 7
WH_XR Roots, 18 day old plants were grown hydroponically 13
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 27
WH_XT Roots, 18 day old plants were grown hydroponically 38
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 26
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 33
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 17
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 63
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242095314|ref|XP_002438147.1|| hypothetical protein SORBIDRAFT_10g008850 [Sorghum bicolor]
Score 1038
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig25168
TTTTTTTTTTTTTTTTTAACACGCCAACAAATATCATATCGGAGAGTATATAAATACAACGGGAAACATGTAACTGCGTGGACAAGAGAACTCACATTAT
TGGCAGCCACGCACAATCACTACAGGTGTTTATTCACGGAGGATATTCCGGATAGCTGAACAACAAGCAACACCAACTTTTTCTCGAGAGAGAAAACACA
GCGACGAAGACACGACATACTGGTATACATATTTGTTGGTCACACACACACGCATAGGCACGATGACGCTGCTCATCTCGTCCGAGCTTTTATTTAATTT
TAGGCGGAACATATCATATGCCGGCATGAACCGATCAGTACTTCTTGCAGGGTCCACCGCAGGTGCCGTCGACGGTGGATTTCATATCCGCGCAGCGCCA
CATTTCGGGGCTCGTCGACACCACGCGGCACGCCGAGCAGCCCTTGGGACACTTGGGGTGGGCGTCGTCGCAGACGTCGACCCCCGAGAAGGACCTGCAG
TTGTTGCAGCACTTGGGGAAGAAGTCGGCGTTGACGTGCGAGAGGACTCCCATGACCAGGACGGCCTGGAGGATCAGGATCGCCGCGAGCTTGGTGCCCT
TCATAGTTGCTGATGAACTTTCAGCGCAAAGCTCTCACTTCACTTGTGTGGAGGAGTAGAATGCTCCTCCTTCCCTCCGCCCACAGCATATTCCTCCAAA
TCTCGCCACCACCCCACCAACGCCACCTCACCGGCGCATCGCATCGCATCGCATGGCGGCTGCGGCGGTGGCCTCCAACGGGGGCGCGGCGCCCGTGCCC
GGGCGCCTCGCGTCCGTCTACAGCGAGGTGCAGACGAGCCGCATCGCGCACGCGCTGCCCCTCCCCTCCGTCCTCCGCTCCCACTTCACCCTCGCCGACG
GGCCCGCCAGCACCGCCGCGGGGAGCCCCGATGAGATCGCCAAGCTGTTCCCCTGCCTGTACGGCCAGCCGTCGGCCGCCGTGGTGCCGTCCGCCGAGCC
GGTCGAGACGAAGCCACTCAAGATCGGCGTCGTGCTCTCCGGTGGCCAGGCGCCAGGCGGGCACAATGTGATCTGCGGCATCTTTGATTACCTGCAGGAG
CGTGCCAAAGGCAGCACCATGTATGGATTCAAGGGAGGCCCAGCTGGGGTCATGAAGGGCAAGTACGTCGAGCTGACCACTGATTTCGTGTACCCCTACA
GAAACCAGGGCGGATTTGATATGATCTGCAGTGGAAGGGACAAGATCGAAACACCAGAGCAGTTCCAGCAAGCTGAAGACACAGTCAACAGACTTGATTT
GGATGGACTTGTTGTCATCGGTGGTGATGATTCAAACACTAACGCATGCCTCCTCGGTGAATACTTCAGGGGAAGGAACTTGAAGACTCGCGTTATTGGT
TGCCCAAAGACTATTGATGGAGATCTGAAATGCAAGGAGGTCCCAACAAGCTTTGGGTTTGACACTGCTTGCAAGATATATTCCGAAATGATTGGCAATG
TCATGACTGATGCACGGTCAACAGGCAAATACTACCACTTTGTGAGGCTTATGGGTCGTGCTGCTTCTCACATTACACTAGAGTGTGCTCTACAGACACA
CCCTAATGTTGCACTCATCGGTGAAGAGGTTGCTGAGAAGAAGGAAACACTCAAGAATGTCACAGACTACATTACCGATGTTGTTTGCAAACGTGCAGAA
CTTGGTTACAACTATGGAGTTGTCCTAATACCGGAAGGCCTGATTGATTTCATCCCAGAGATTCAAAAACTCATTGCAGAATTGAATGAAATTTTGGCAC
ATGATGTTGTTGACGAGGCAGGGGCTTGGAAAAGCAAGCTTGAACCAGCATCTAGGGAGTTGTTTGACTTCTTGCCCAAAACCATTCAGGAGCAGCTTTT
GCTTGAAAGAGATCCCCATGGCAATGTTCAGGTTGCAAAAATTGAAACTGAGAAAATGCTTATTGCCATGGTTGAAACTGAATTGGAGAAGAGAAGAGCG
GCGGGGAAGTACTCTGCACATTTCAGAGGCCAGTCTCACTTCTTCGGATATGAAGGAAGATGCGGCCTCCCTACCAATTTTGATTCCAGCTATTGCTATG
CATTAGGCTATGGTGCTGGTGCTCTTCTCCAATTTGGCAAGACAGGACTTATTTCGTCGGTTGGTAACCTGGCTGCTCCTGTGGAAGAATGGACTGTTGG
AGGAACTGCACTGACTGCGTTGATGGATGTTGAGAGAAGGCATGGCAAGAACAAGCCAGTGATCAAGAAGGCTATGGTGGAACTTGATGCTGCGCCATTT
AAGAAGTTTGCCTCGCTGCGAGATGAATGGGCCAGCAAGAACCGATACATCAGCCCTGGTCCCATCCAGTTCAGCGGCCCTGGAAGCGATGCGTCGAACC
ATACCTTGATGTTGGAGCTTGGCGCTGAGATATAGAGGCGGCGGTGTAGAGTGTATTTCTTTCAAATTTTCTACTTCTTCCTTGCAGTTTTGAGAGTGGA
GAACAAACTCCCATAGCGGAGCGGCAGTCTCCGCATTGTGGAATGTTTAATAAGAGGTTGAGTTGGAGTGGGTTCAGTGGATGTCGTAATAACTAATTTT
AGCTTTTTTATGACCCGATTGCTCCCCATATATCGAACCCCCGCCTACCCCTGAAGTTTTTTTTTCCAACTGTCAAAAAAAAAA
page-top