Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig25151  (registered. 2012)
Contig Information
Length 944 bp
Clones alternative view 51 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_f Spike at flowering date 3
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 8
WH_XV Leaves, plant was grown at constant 23 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|4204859|gb|AAD11549.1|| heat shock protein 80 [Triticum aestivum]
Score 429
Evalue 2.00E-118
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig25151
CTCGAGAAACTTCACCGAGAAATACAGGAATTCGCAATAAAAAGCCAAGAAGGCCAGCAGAAAGCAAAAAGAGCAAACAAGGCGATTAACTCGGAAGGTA
CTAAAGACGATATATATAAGCAACGATTACGGTACGCAGTTCCGGGGACTCCACAGACCACTCCCCTAGCCCCATTAGGGCAGGCTAGGCACAGTAAACC
ACAAAAGACAAACCGACCACGCGACAGTAACCCAAAAGATAAACTAGCTCTAGGACTCGGATAGCAAGCAAATGCACACGCCTAGTCGACCTCCTCCATC
TTGCTCTCGCCGGCGTCCTCCTCCAACGGCGGCATGTCCGTGTCAGCCTCAGCAGCCTCCTCGTCCTCGTCGATGCTCAGGCCCAGCTTGAGCATGCGGT
GGATCCTGGTGCCGAAGGTGTTGGGGTCGTCAAGGCTGAAGCCCGAGGTGAGCAGGGAGGTCTCGAACAGCAGCATCACCAGGTCCTTGACAGACTTGTC
GTTCTTGTCCACGTCGGCGCGCTTGCGCAGCTCCTCCATGATGGCGTTCTCTGGGTTGATCTCCATCGTCTTCTTGCTCGACATGTAGCCGCCCATGCTC
GTGTCCCTCAGGGCCTGGGCCTTCATGATCCTCTCCATGTTGGCGGTCCAGCCGTACTCGCCGGTGACGAGGCAGCACGGTGAGTCGACGACGCGGTCAG
AGACGATCACCTTCTCAACCCTGTCGCCCAGCACCTCCTTGATCACCTTGCAGAGCCCCTCGAACTTCTCCTTGAGCTCCTCCTTCCTCTTCTTCTCTTC
CTCGCTGTCATCAAGCTTCAGGCCCTCCTTGGTGGCGGAGACCAGCTTCTTTCCCTCAAACTCCTTGAGCTGGCCAATGGAGTACTCATCAATGGCGTCA
ACCATGTACAGCACCTCATAGCCCTTCTTCTTCAGCTTCTCAAG
page-top